Labshake search
Citations for Bioline :
251 - 300 of 1617 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Quantitative PCR was performed according to the manufacturer’s instructions (Bioline). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... RNA samples were reverse transcribed using the SensiFAST cDNA synthesis kit (Bioline). Quantitative PCR was performed according to the manufacturer’s instructions (Bioline) ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR® kit (Bioline) and primers specific for the membrane protein gene of HCoV-OC43 and HCoV-229E (Vijgen et al. ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... and real-time qPCR using primer sets (CYP1A1: CAACCCTTCCCTGAATGCCT and GCTTCTCCTGACAGTGCTCA; CYP1B1: AACGTACCGGCCACTATCAC and TCACCCATACAAGGCAGACG) and 2x SensiMix SYBR & Fluorescein Mastermix (Bioline QT615-05) on the iCycler (Bio-Rad).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1.0 unit BioTaq (Bioline USA Inc.), 1 x BioTaq reaction buffer ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 20 µl of the epPCR served as a template for a second 1 ml standard PCR with 25 cycles using BioTaq polymerase (Bioline) and primers CW1&2 as previously described49 ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA extraction was performed using the Isolate II RNA Plant kit (Bioline, London, England).
-
bioRxiv - Immunology 2023Quote: ... using random hexamers (Bioline Reagents Ltd) following the manufacturer’s protocol.
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... 0.5 µg of RNA was used to generate cDNA using Tetro cDNA synthesis kit (Bioline BIO-65043) in a 10 µl reaction using a 1:1 ratio of random hexamer and oligo (dT)18 primer mix as per manufacturer instructions ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... RNA was extracted using ISOLATE II RNA Mini kit as per manufacturer instructions (Bioline BIO-52072) and RNA concentration and quality determined by Nanodrop (Thermo Fisher) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we placed at least 50 seeds (exact number of seeds Table S1) per temporal origin on moist potting soil (Einheitserde®, BioLine, Pikiersubstrat) in trays (TEKU® ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from Mediterranean and temperate species had germinated we transplanted up to 20 seedlings each into 9 × 9 cm pots (one plant per pot) with a 3:1 mixture of potting soil (Einheitserde®, BioLine, Topfsubstrat Öko torffrei) and sand (0-2 mm play sand ...
-
bioRxiv - Microbiology 2023Quote: ... using SensiFAST SYBR Hi-ROX (Bioline). A total cDNA concentration of 100 ng in combination with 200 nM of dapE oligonucleotide per reaction (Supplementary Table 5 ...
-
bioRxiv - Neuroscience 2023Quote: Human samples: qPCR experiments were conducted using the SensiFAST Probe Hi-ROX Master Mix (Bioline) and the TaqMan Gene Expression Assays (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... First strand cDNA synthesis was performed using the Tetro cDNA synthesis kit (Bioline). Quantitative PCR (qPCR ...
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... plasmids were extracted (Bioline BIO-52057) and correct insertion of the guide RNA sequence confirmed by sequencing.
-
Quantitative Comparison of Presenilin Protein Expression Reveals Greater Activity of PS2-γ-SecretasebioRxiv - Cell Biology 2023Quote: ... and gel purified (Bioline BIO-52060) as per supplier protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized by using the SensiFAST cDNA Synthesis kit (Bioline, London, England). Gene expression levels were measured using a MicroAmp Fast Optical 96-well Reaction Plate with Barcode ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT–qPCR was performed using the SensiFAST Syber Low-ROX kit (Bioline) QuantStudio 3 RealTime qPCR (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mg of total RNA was retrotranscribed in cDNA using the SensiFAST cDNA Synthesis KIT (Bioline). Specific sets of primer pairs were designed and tested with primerBLAST (NCBI ...
-
bioRxiv - Molecular Biology 2023Quote: ... a dUTP mix (Bioline), containing dATP ...
-
bioRxiv - Plant Biology 2023Quote: ... qPCR was performed in 96-well plates using the SensiFastTM SYBR No-ROX Kit (Bioline) in technical triplicates for each biological replicate ...
-
bioRxiv - Plant Biology 2023Quote: The subsequent amplification step of the PCR was performed using MangoTaq™DNA Polymerase (Bioline, Belgium) and the primers LCO1490 and HCO2198 designed by Folmer et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and diluted 1:10 before quantification using the SensiFAST SYBR No-Rox kit (Bioline, BIO-98005). qRT-PCR was performed with 1 μM of each primer (a common reverse primer for both Trm1 isoforms and isoform-specific forward primers ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 unit of Taq polymerase (Bioline, Meridian Bioscience). The PCR conditions were an initial melting step of 94°C for 4 min ...
-
bioRxiv - Bioengineering 2023Quote: ... My Taq PCR master mix (Bioline) that included buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 µg of RNA was reverse transcribed to cDNA using SensiFAST cDNA Synthesis Kit (Bioline #65054). qPCR reactions were set up using PowerUp SYBR Green Master Mix (Applied Biosystems #A25742 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 µl of 1:10 diluted cDNA was added to 7.5 µl of Sensi-FAST SYBR No-ROX (Bioline) and 400 nM of forward and reverse primers in a 15 µl final volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... The SensiFAST SYBR Lo-ROX Kit (Bioline, #BIO-94020) was utilized for the qRT-PCR ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were purified using the ISOLATE II PCR and Gel Kit (Bioline, BIO-52060) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Two microliters of cDNA was used for subsequent amplification using SensiFAST SYBR No-Rox Kit (Bioline) on an Eco™ Real-Time PCR System (Ilumina) ...
-
Local adaptation of Arabidopsis thaliana in a small geographic region with mild environmental clinesbioRxiv - Plant Biology 2023Quote: ... Reverse transcriptase quantitative PCR (RT-qPCR) reactions were performed with the SensiFast SYBR Green Mastermix (Bioline) on a Bio-RAD cfx96 machine ...
-
bioRxiv - Plant Biology 2023Quote: ... Roots were mounted in water under a pad of 0.8% agarose (Bioline). Imaging was performed using a CSU-W1 spinning disk head (Yokogawa ...
-
bioRxiv - Genetics 2023Quote: ... 2 µl aliquots of cDNA (corresponding to 20 ng of cDNA) were used in qPCR using SYBR green containing supermix (Bioline) on the Biorad CFX96 thermal cycler (Biorad ...
-
bioRxiv - Genetics 2023Quote: ... 1 µg of RNA was used to prepare cDNA using the Sensifast cDNA synthesis kit (Bioline, London, UK). 2 µl aliquots of cDNA (corresponding to 20 ng of cDNA ...
-
bioRxiv - Plant Biology 2023Quote: ... using SensiFAST SYBR No-ROS kit (Bioline, BIO-98020) following this program ...
-
bioRxiv - Cell Biology 2023Quote: ... assays and SensiFAST™ Probe Hi-ROX Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... assays and SensiFAST™ Probe Hi-ROX Kit (Bioline) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline). Gene expression was measured using qRT-PCR using TaqMan (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was isolated from lung homogenates from mice exposed to E-cigarettes (with and without nicotine) and room air (SHAM) using Isolate II RNA Mini Kit (Bioline) and cDNA was synthesized using SensiFAST cDNA Synthesis kit (Bioline) ...
-
bioRxiv - Pathology 2023Quote: ... using SensiFAST SYBR NO ROX kit (Bioline). Fluorescent dye intensity was analyzed and quantified with linear regression ...
-
bioRxiv - Plant Biology 2023Quote: Further RNA purification was performed using the Isolate II RNA Plant Kit (Bioline). Washing ...
-
bioRxiv - Molecular Biology 2023Quote: The Tetro cDNA Synthesis Kit (Bioline; BIO-151 65043) was used to transcribe mRNA into cDNA according to the manufacturer’s manual ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 ng of total RNA was converted to complementary DNA (cDNA) using SensiFASTTM cDNA synthesis kit following manufacturer instructions (Bioline) and qPCR performed using SensiFAST™ SYBR® Lo-ROX Kit following manufacturer instructions (Bioline) ...
-
bioRxiv - Plant Biology 2023Quote: ... purified and converted to cDNA with sensiFAST cDNA Synthesis Kit (Bioline), using the provided mix of random hexamers and anchored oligo dT primers ...
-
bioRxiv - Microbiology 2023Quote: ... with MyTaqTM HS Red Mix (Bioline), thermocycling conditions used were as follows ...
-
bioRxiv - Genetics 2023Quote: Ostrinia nubilalis Hbn.eggs were obtained from Bioline AgroSciences (France) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Whole midguts were first dissected into 180 μL lysis buffer GL (Bioline) and 20 μL Proteinase K and incubated at 56°C for 1 hour to ensure efficient lysis of oocysts ...