Labshake search
Citations for Millipore Sigma :
2401 - 2450 of 2658 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product was digested with restriction enzymes and then ligated into pET-17b (Merck Millipore, Burlington, MA, USA) to construct the expression vector pStSOR ...
-
bioRxiv - Microbiology 2022Quote: ... hawaiiensis NRRL 15010 were obtained by ligating PCR-amplified gene sequences with linearized pET11a or pET22b vectors (Merck-Novagen), respectively ...
-
bioRxiv - Immunology 2019Quote: ... Cell lines were confirmed as mycoplasma negative before their use in experiments using a PCR-based assay (Sigma Aldrich).
-
bioRxiv - Developmental Biology 2020Quote: Genomic DNA extractions were performed with Extract-N-Amp or REDExtract-N-Amp™ Tissue PCR Kits (Sigma-Aldrich). Whole embryos or adult zebrafish fin-clips were lysed by incubation in a mixture of 50 μL extraction solution (Extraction Solution E7526 ...
-
bioRxiv - Zoology 2020Quote: PCR amplification of two genomic regions were performed using 12.5 μl of the Extract-N-AmpTM Tissue PCR kit (Sigma), 1 μl of each primer ...
-
bioRxiv - Genomics 2020Quote: ... All iPSCs and cerebral organoids were tested negative for mycoplasma using the LookOut Mycoplasma PCR Detection kit (Sigma MP0035). iPSCs from all donors were passaged until they were confluent ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mycoplasma contamination check was carried out using a LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich, St. Louis, MO, USA). Cells were validated by STR profiling.
-
bioRxiv - Neuroscience 2020Quote: ... 15792 single microglia were collected in 384-well PCR plates containing cell lysis buffer (0,2% Triton (Sigma-Aldrich, T9284), 4 U RNAse inhibitor (Takara ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli genes for proteins bS6 and bL9 were PCR-amplified and cloned individually into the pET28(a) plasmid (Novagen). Recombinant single-cysteine proteins were then expressed ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell cultures were examined periodically for bacteria contamination and tested for mycoplasma by LookOut Mycoplasma PCR Detection Kit (Sigma).
-
bioRxiv - Genomics 2021Quote: ... First-strand synthesis was then performed by incubation at 25 °C for 10 min and 50 °C for 50 min on a PCR cycler with 7.6 μl of the following mix: 0.2 μg actinomycin (Sigma A1410), 13.15 mM DTT (Life Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were used to synthesize dsRNA using a T7 RNA Polymerase Kit (Sigma-Aldrich RPOLT7-RO ROCHE). Generated dsRNAs were treated with TURBO DNA-free Kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gene encoding Cas7-11 was amplified by PCR and cloned into the modified pACYCDuet-1 plasmid vector (Novagen), expressing Cas7-11 with an N-terminal maltose-binding protein (MBP ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested for mycoplasma every three months using the Lookout Mycoplasma PCR detection kit (Sigma-Aldrich) and were authenticated by ATCC®.
-
bioRxiv - Cell Biology 2022Quote: ... OGG1 sequence was PCR amplified from pPR71 (8) cloned into NdeI/EcoRI sites of the overexpression vector pET30a (Novagen). The recombinant pET30a-hOGG1 was used as a template to introduce Y203A and N149A/N150A (referred to as 2NA ...
-
bioRxiv - Genomics 2022Quote: ... Puromycin or neomycin-resistant cell clones were screened by genomic PCR using KOD Xtreme hot-start DNA polymerase (Millipore).
-
bioRxiv - Microbiology 2022Quote: ... PCR products (10 μL) were visualized by gel electrophoresis in 1% (w/v) agarose gels (Sigma-Aldrich, Darmstadt, Germany). Sequencing was performed (LGC Genomics GmbH ...
-
bioRxiv - Developmental Biology 2024Quote: ... and pinx1 were generated from pCRII-TOPO vectors or PCR products using a digoxigenin RNA labeling kit (Sigma-Aldrich). For Supplementary Fig ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting PCR product was digested with XhoI and NcoI and introduced into the pET-28a vector (Merck Millipore). The ModA E165A ...
-
bioRxiv - Developmental Biology 2023Quote: ... we deployed a rapid lysis protocol using reagents from the SYBR Green Extract-N-Amp Tissue PCR Kit (Sigma) (Doan and Monuki ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were regularly tested for mycoplasma contamination using a LookOut® Mycoplasma PCR Detection kit (Sigma, MP0036).
-
bioRxiv - Biochemistry 2023Quote: Amplified genes were cloned into pJET1.2 vector with the CloneJET PCR Cloning Kit (ThermoScientific) and further subcloned into pET30a and pET-DUET1 (Novagen) for protein expression in E ...
-
bioRxiv - Developmental Biology 2023Quote: ... Both hiPSC lines were checked for mycoplasma contamination and tested negative (LookOut Mycoplasma PCR Detection Kit, Sigma-Aldrich MP0035).
-
bioRxiv - Developmental Biology 2023Quote: Genomic DNA was extracted from mouse tail tip samples using the REDExtract-N-Amp Tissue PCR kit (Sigma-Aldrich). PCR was performed using the REDExtract-N-Amp PCR Readymix (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Single embryos were transferred using a mouth-pipette from the imaging dish into PCR tubes containing 10μl lysis buffer composed of PCR buffer (Fermentas, EP0402) supplemented with 0.2 mg/ml Pro teinase K (Sigma, P8811). Embryos in the lysis buffer were incubated at 55°C for 1 hour and then at 96°C for 10 minutes ...
-
bioRxiv - Pathology 2023Quote: ... cDNA was measured by quantitative PCR with FastStart Universal SYBR Green Master (Rox) (04913850001, Sigma-Aldrich, St. Louis, MO) using QuantStudio 6 (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA extracted from parasite cultures was regularly tested for Mycoplasma contamination (look out Mycoplasm PCR detection kit (Sigma)) using MSP primers 44 All transgenic P ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were loaded directly onto a 2% TAE agarose gel with GelRed Nucleic Acid Gel Stain (Sigma-Aldrich) for electrophoresis ...
-
bioRxiv - Plant Biology 2024Quote: ... The resulting 438-bp PCR product was digested with BamHI and HindIII and cloned into the pETDuet vector (Novagen) (pMS1079) ...
-
bioRxiv - Plant Biology 2020Quote: ... and hybridized overnight at 38°C with 32P-labeled probes for the intergenic region (IR) of the viral genome amplified by PCR (Fw: TCCTCTTTAGAGAGAGAACAATTGGGA, Rv: ACAACGAAATCCGTGAACAG) or oligonucleotides in PerfectHyb buffer (Sigma). Washed membranes were exposed to X-ray films at −80 °C for 3 days.
-
bioRxiv - Microbiology 2020Quote: ... The amplified PCR products were digested with NdeI and XhoI restriction endonucleases and subsequently cloned into the pET28a vector (Novagen). Confirmation of the correct nucleotide sequence of pelX was achieved through DNA sequencing (ACGT DNA Technologies Corporation) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1143-1300 of human RTEL1 were amplified by PCR then subcloned between the EcoRI and XhoI restriction sites of pET28 (Novagen). RTEL1 proteins were expressed as 6-histidine-fusions in the E ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fetal tails were kept for sex determination by detection of the Sry gene using the Taq Ready PCR system (Sigma), specific primers (Sry ...
-
bioRxiv - Cell Biology 2020Quote: The open reading frame of clik-1 cDNA was amplified with reverse-transcriptase-PCR and cloned at the NdeI - BamHI sites of pET-3a (Novagen) with no extra tag sequence ...
-
bioRxiv - Cell Biology 2020Quote: ... the pronuclei were transferred to 0.2 ml PCR tubes in 3 μl sample buffer covered with mineral oil (Sigma-Aldrich) and were decrosslinked at 65°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... E11.5 embryos were dissected into ice-cold PBS and associated yolk sacs used for rapid genotyping using the Extract-N-Amp Tissue PCR kit as recommended by the manufacturer (Sigma). During genotyping ...
-
bioRxiv - Developmental Biology 2020Quote: ... genomic DNA was extracted from single blastocysts by placing each blastocyst in a microtube containing 4.4 µl Extraction buffer (REDExtract-N-Amp Tissue PCR Kit, Millipore Sigma) mixed with 1.1 µl of Tissue Prep Buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... using PCR fragment amplified from pCAG-MV-GagPol-INKV1772-CTEx2 (44, 45) and NdeI/XhoI-linearized pET-22b(+) (Millipore Sigma). MVV IN proteins and human LEDGF/p75 were produced in bacteria and purified as previously described (1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real time quantitative PCR was performed with KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich - Merck, UK, cat no KK4602) according to manufacturer’s instructions in a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was PCR amplified from a FANTOM clone (AK139786) and cloned into NdeI and XhoI sites of the pET19b vector (Novagen).
-
bioRxiv - Molecular Biology 2021Quote: ... of wild-type Rad6 or an A126 mutant was PCR amplified and inserted by SLIC into BamH1-Not1 sites in bacterial expression vector pRSF-Duet (Novagen). Subsequently ...
-
bioRxiv - Plant Biology 2019Quote: ... the 1823 bp CDT1a promoter and the 1577 bp 5’ moiety of gCDT1a gene were amplified by PCR using the KOD polymerase (Millipore) and domesticated into the pUPD2 ...
-
bioRxiv - Cell Biology 2019Quote: ... 1690–1937) were amplified by PCR from the full-length cDNA and sub-cloned into pET28-a (+) or pET28-b (+) (Novagen). Human Nup58FG-N (aa ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR of tetur01g11270 fragments (amplicon 1 and 2) was conducted using the Expand™ Long Range dNTPack (Sigma-Aldrich). PCR reaction mixtures were prepared according to the manufacturer’s instructions and using the following temperature profile ...
-
bioRxiv - Developmental Biology 2019Quote: ... Repair templates and DNA fragments for cloning were generated by PCR amplification with either High Fidelity Hot Start KOD DNA Polymerase (Novagen) or Phusion Hot Start DNA Polymerase (Finnzymes) ...
-
bioRxiv - Genetics 2019Quote: ... 1000 ng of PCR-generated repair template and 5 µl (10 µg/µl) of salmon sperm carrier DNA (Sigma #D7656) and the tube was incubated on a turning wheel at 30°C for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA sequence corresponding to sim-PD (aa 361-672) was PCR amplified and cloned in-frame with a 6xHis-Tag into a modified pET-14b plasmid (Novagen). The expression plasmid was transformed into BL21 competent E ...
-
bioRxiv - Genetics 2020Quote: ... All products of the sequencing PCR were cleaned via passage through individual Sephadex clean up columns (Sigma-Aldrich, Gillingham, UK), to remove any unincorporated dye terminator products and diluted with 10µl of DNA free water ...
-
bioRxiv - Neuroscience 2021Quote: All primers were provided from Thermo Fisher and the REDExtract-N-Amp PCR Reaction Mix™ reagent used for the polymerase reaction was provided from Sigma-Aldrich® ...
-
bioRxiv - Biochemistry 2020Quote: ... Each protein encoding DNA fragment was assembled with the mCherry-PCR fragment and NdeI and HindIII digested pET22b vector (Novagen), using a Gibson assembly reaction (New England Biolabs) ...