Labshake search
Citations for Millipore Sigma :
2251 - 2300 of 2519 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The cell lines were tested for mycoplasma contamination using the LookOut® Mycoplasma PCR Detection Kit (Sigma Millipore) and were found to be negative for mycoplasma.
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse genotypes were determined by PCR using genomic DNA extracted using the REDExtract-N-Amp kit (Sigma XNAT) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... mice DNA was extracted from ear notches or tails using the RED ExtractN-Amp Tissue PCR Kit (SIGMA). For Lrp1flox ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were inspected for mycoplasma contamination using a VenorTM GeM Mycoplasma Detection kit PCR-based (Sigma, MP0025-1KT).
-
bioRxiv - Microbiology 2021Quote: ... and oriT from pUC18T-mini-Tn7T-Tp-dsRedExpress were PCR amplified and introduced into a linearized pYES1L plasmid (Novagen) using the Gibson assembly method 46 (Supplementary Fig ...
-
bioRxiv - Immunology 2021Quote: ... The gene sequence was amplified without the signal sequence and then PCR amplicons were ligated into the E.coli expression vector pET28a (Novagen) at the restriction sites shown in Table 1 ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real-time PCR using cDNA was performed using KAPA SYBR fast qPCR master mix kit (Sigma Aldrich, USA) and Applied Biosystems StepOne Plus Real-Time PCR system ...
-
bioRxiv - Microbiology 2019Quote: ... Size of the PCR products was verified by gel electrophoresis and purified using an Amicon Ultra 0.5 ml kit (Millipore).
-
bioRxiv - Cell Biology 2020Quote: ... and 2μL of purified gDNA was added to 5μL of the 2X REDExtract-N-Amp PCR ReadyMix (Sigma-Aldrich), 0.2μL 10μM forward/reverse primer mix ...
-
bioRxiv - Neuroscience 2020Quote: ... A 96-well PCR plate was prepared with one 3 mm diameter borosilicate solid-glass bead (Millipore Sigma #Z143928) and 100 µl PBS in each well ...
-
bioRxiv - Cancer Biology 2021Quote: ... Coding region of H3.1 along with Flag-Tag was amplified by PCR using KOD Hot Start DNA Polymerase (Millipore) and cloned into gateway entry vector pENTR/D-TOPO vector (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR was performed with KiCqStart™SYBR®Green qPCR ReadyMix™(Sigma-Aldrich, St. Louis, MO, USA) using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... while PCRs to generate specific knock-in constructs (mAID fusions and epitope tagging) were performed with KOD polymerase (Novagen). Specific gRNA were generated using the Q5 site-directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Immunology 2020Quote: ... PCRs for genotyping of bacterial colonies after transformation were performed using the KAPA2G Fast ReadyMix kit (Sigma Aldrich, #KK5102) with custom designed primers and the following cycling conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... Single endosteal and central marrow stromal cells were directly sorted into individual wells of a 96-well PCR plate in 2.3 μl of lysis buffer containing 0.2% Triton X-100 (Sigma-Aldrich) and 1U of Superase-In RNase Inhibitor (Ambion) ...
-
bioRxiv - Neuroscience 2022Quote: ... The membrane was hybridized with a digoxigenin-labeled DNA probe generated with a PCR DIG Probe Synthesis Kit (Sigma). Hybridization with a 5’ probe produced an 8.1 Kb band from the WT and a 5.1 Kb band from the targeted locus ...
-
bioRxiv - Microbiology 2022Quote: The PCR products were inserted into the pET-30 Ek/LIC vector according to manufacturer’s instructions (LIC Kit, Novagen) (Table S2) ...
-
bioRxiv - Microbiology 2022Quote: ... the TAR vectors were PCR amplified from pCC1BAC-his3 with KOD Xtreme Hot Start DNA polymerase (Millipore, Burlington, MA) using the construction primers (labeled “Con” ...
-
bioRxiv - Plant Biology 2021Quote: ... Half of the MET3 PCR product was digested for 1h30 at 37°C with XbaI restriction enzyme (Sigma-Aldrich). ACT2 amplification was used as a control.
-
bioRxiv - Plant Biology 2021Quote: ... RNA was crosslinked using UV light and hybridized with a DIG labelled probe (PCR DIG probe synthesis kit, Sigma). For detection of LbuCas13a the membrane was stripped and probed with DIG labelled Cas13a specific probe and signal detected on a Licor Odyssey imaging system (LI-COR Bioscience ...
-
bioRxiv - Plant Biology 2021Quote: ... a 2.25-kb fragment containing the PHOT1 CDS was amplified by PCR with KOD hot start DNA polymerase (Novagen) using PHOT1 FW and PHOT1 RV primers (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product was digested with restriction enzymes and then ligated into pET-17b (Merck Millipore, Burlington, MA, USA) to construct the expression vector pStSOR ...
-
bioRxiv - Microbiology 2022Quote: ... hawaiiensis NRRL 15010 were obtained by ligating PCR-amplified gene sequences with linearized pET11a or pET22b vectors (Merck-Novagen), respectively ...
-
bioRxiv - Immunology 2019Quote: ... Cell lines were confirmed as mycoplasma negative before their use in experiments using a PCR-based assay (Sigma Aldrich).
-
bioRxiv - Developmental Biology 2020Quote: Genomic DNA extractions were performed with Extract-N-Amp or REDExtract-N-Amp™ Tissue PCR Kits (Sigma-Aldrich). Whole embryos or adult zebrafish fin-clips were lysed by incubation in a mixture of 50 μL extraction solution (Extraction Solution E7526 ...
-
bioRxiv - Zoology 2020Quote: PCR amplification of two genomic regions were performed using 12.5 μl of the Extract-N-AmpTM Tissue PCR kit (Sigma), 1 μl of each primer ...
-
bioRxiv - Genomics 2020Quote: ... All iPSCs and cerebral organoids were tested negative for mycoplasma using the LookOut Mycoplasma PCR Detection kit (Sigma MP0035). iPSCs from all donors were passaged until they were confluent ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mycoplasma contamination check was carried out using a LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich, St. Louis, MO, USA). Cells were validated by STR profiling.
-
bioRxiv - Neuroscience 2020Quote: ... 15792 single microglia were collected in 384-well PCR plates containing cell lysis buffer (0,2% Triton (Sigma-Aldrich, T9284), 4 U RNAse inhibitor (Takara ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli genes for proteins bS6 and bL9 were PCR-amplified and cloned individually into the pET28(a) plasmid (Novagen). Recombinant single-cysteine proteins were then expressed ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell cultures were examined periodically for bacteria contamination and tested for mycoplasma by LookOut Mycoplasma PCR Detection Kit (Sigma).
-
bioRxiv - Genomics 2021Quote: ... First-strand synthesis was then performed by incubation at 25 °C for 10 min and 50 °C for 50 min on a PCR cycler with 7.6 μl of the following mix: 0.2 μg actinomycin (Sigma A1410), 13.15 mM DTT (Life Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were used to synthesize dsRNA using a T7 RNA Polymerase Kit (Sigma-Aldrich RPOLT7-RO ROCHE). Generated dsRNAs were treated with TURBO DNA-free Kit (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gene encoding Cas7-11 was amplified by PCR and cloned into the modified pACYCDuet-1 plasmid vector (Novagen), expressing Cas7-11 with an N-terminal maltose-binding protein (MBP ...
-
bioRxiv - Cell Biology 2022Quote: ... All cell lines were tested for mycoplasma every three months using the Lookout Mycoplasma PCR detection kit (Sigma-Aldrich) and were authenticated by ATCC®.
-
bioRxiv - Cell Biology 2022Quote: ... OGG1 sequence was PCR amplified from pPR71 (8) cloned into NdeI/EcoRI sites of the overexpression vector pET30a (Novagen). The recombinant pET30a-hOGG1 was used as a template to introduce Y203A and N149A/N150A (referred to as 2NA ...
-
bioRxiv - Genomics 2022Quote: ... Puromycin or neomycin-resistant cell clones were screened by genomic PCR using KOD Xtreme hot-start DNA polymerase (Millipore).
-
bioRxiv - Microbiology 2022Quote: ... PCR products (10 μL) were visualized by gel electrophoresis in 1% (w/v) agarose gels (Sigma-Aldrich, Darmstadt, Germany). Sequencing was performed (LGC Genomics GmbH ...
-
bioRxiv - Developmental Biology 2023Quote: ... we deployed a rapid lysis protocol using reagents from the SYBR Green Extract-N-Amp Tissue PCR Kit (Sigma) (Doan and Monuki ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were regularly tested for mycoplasma contamination using a LookOut® Mycoplasma PCR Detection kit (Sigma, MP0036).
-
bioRxiv - Biochemistry 2023Quote: Amplified genes were cloned into pJET1.2 vector with the CloneJET PCR Cloning Kit (ThermoScientific) and further subcloned into pET30a and pET-DUET1 (Novagen) for protein expression in E ...
-
bioRxiv - Developmental Biology 2023Quote: ... Both hiPSC lines were checked for mycoplasma contamination and tested negative (LookOut Mycoplasma PCR Detection Kit, Sigma-Aldrich MP0035).
-
bioRxiv - Developmental Biology 2023Quote: Genomic DNA was extracted from mouse tail tip samples using the REDExtract-N-Amp Tissue PCR kit (Sigma-Aldrich). PCR was performed using the REDExtract-N-Amp PCR Readymix (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Single embryos were transferred using a mouth-pipette from the imaging dish into PCR tubes containing 10μl lysis buffer composed of PCR buffer (Fermentas, EP0402) supplemented with 0.2 mg/ml Pro teinase K (Sigma, P8811). Embryos in the lysis buffer were incubated at 55°C for 1 hour and then at 96°C for 10 minutes ...
-
bioRxiv - Pathology 2023Quote: ... cDNA was measured by quantitative PCR with FastStart Universal SYBR Green Master (Rox) (04913850001, Sigma-Aldrich, St. Louis, MO) using QuantStudio 6 (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and pinx1 were generated from pCRII-TOPO vectors or PCR products using a digoxigenin RNA labeling kit (Sigma-Aldrich). For Supplementary Fig ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting PCR product was digested with XhoI and NcoI and introduced into the pET-28a vector (Merck Millipore). The ModA E165A ...
-
bioRxiv - Plant Biology 2020Quote: ... and hybridized overnight at 38°C with 32P-labeled probes for the intergenic region (IR) of the viral genome amplified by PCR (Fw: TCCTCTTTAGAGAGAGAACAATTGGGA, Rv: ACAACGAAATCCGTGAACAG) or oligonucleotides in PerfectHyb buffer (Sigma). Washed membranes were exposed to X-ray films at −80 °C for 3 days.
-
bioRxiv - Microbiology 2020Quote: ... The amplified PCR products were digested with NdeI and XhoI restriction endonucleases and subsequently cloned into the pET28a vector (Novagen). Confirmation of the correct nucleotide sequence of pelX was achieved through DNA sequencing (ACGT DNA Technologies Corporation) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1143-1300 of human RTEL1 were amplified by PCR then subcloned between the EcoRI and XhoI restriction sites of pET28 (Novagen). RTEL1 proteins were expressed as 6-histidine-fusions in the E ...