Labshake search
Citations for Millipore Sigma :
6801 - 6850 of 7813 citations for rno mir 148b 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Total protein staining solution (REVERT Total Protein Stain kit, LI-COR Inc., # 926-11010; Pyronin Y (Sigma-Aldrich # P9172)
-
bioRxiv - Cell Biology 2021Quote: Senescence-associated β-galactosidase (SA-β-gal) activity was determined with the Senescence Cells Histochemical Staining Kit (Sigma-Aldrich). Six representative images were captured on a TS100 inverted light microscope (Nikon ...
-
bioRxiv - Cancer Biology 2021Quote: ... and GM-CSF levels were quantified using ELISA kits pre-coated with indicated capture antibodies per manufacturer’s instructions (Sigma). IL-6 levels were preliminarily detected using a Q-Plex Human cytokine screen (16-plex ...
-
bioRxiv - Bioengineering 2021Quote: A phosphate assay was performed according to the manufacturer’s instruction (Malachite Green Phosphate Assay Kit, Sigma-Aldrich, The Netherlands). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... analyzed with the Duolink In Situ Red Mouse/Rabbit kit assay according to the manufacturer’s instructions (DUO94001, Sigma-Aldrich). In brief ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from apple leaves with the Spectrum Plant Total RNA Kit (Sigma-Aldrich, St. Louis, MO). Two micrograms of total RNA were treated with DNAse (Ambion ...
-
bioRxiv - Plant Biology 2021Quote: Genomic DNA was extracted from leaves using the GenElute Plant Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, USA). The integrity of the DNA was verified by electrophoresis on a 1% agarose gel stained with ethidium bromide ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was isolated in an endotoxin-free manner (GenElute™ HP Endotoxin-Free Plasmid Maxiprep Kit; Sigma-Aldrich) and concentrated using paramagnetic beads (HighPrep PCR Clean Up System ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... total RNAs were isolated from young buds or leaves using the Spectrum™ Plant Total RNA Kit (SIGMA-ALDRICH). Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The pellets were then resuspended in 300µl of cold L-Amino Acid Assay buffer according to the manufacturer instructions (L-Amino Acid Quantification kit, Sigma) and lysates were then centrifuged at 13,000 rpm for 10min at 4°C to remove insoluble material ...
-
bioRxiv - Microbiology 2021Quote: ... Metabolite peaks were confirmed using the mass spectrometry metabolite library kit MSMLS-1EA (Sigma Aldrich supplied by IROA Technologies).
-
bioRxiv - Microbiology 2020Quote: Bacterial DNA was isolated and purified with the GenEluteTM Bacterial Genomic DNA kit (Sigma-Aldrich, St. Louis, Missouri, USA). PCR was used for the identification of six virulence factor genes (fliL ...
-
bioRxiv - Plant Biology 2021Quote: RNA from frozen ground stem samples was extracted using a Plant Total RNA extraction kit (Sigma, St Louis, MO) with modifications to the kit protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid was purified using a Qiagen Maxi kit and resuspended in CytoMix (25 mM HEPES, pH 7.6, 2 mM EGTA (Sigma), 5 mM MgCl2 (Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... The glycogen content was measured with a fluorometric method as described in the MAK016 assay kit instructions (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2021Quote: RNA immunoprecipitation assay was carried out according to the Magna RIP RNA-Binding Protein Immunoprecipitation Kit manufacturer’s instruction (Millipore). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... using First strand cDNA synthesis kit (Fermentas K1612) qPCR was performed using Fast Start Universal Master mix (ROX) (Sigma) using exon spanning primers:-IL17A_Fp TGGAATCTCCACCGCAATGA ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were stained for SA-β-galactosidase activity overnight using a Cellular Senescence Assay kit (Merck Millipore, Massachusetts, USA) and imaged the next day in the motorised widefield microscope Cell Observer (Zeiss ...
-
bioRxiv - Cancer Biology 2020Quote: Protein co-localization was assessed via proximity ligation assay (PLA) using the Duolink In Situ Red Starter Kit (Sigma) and PLA-approved primary antibodies for SC-35 (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell counting and viability were performed Muse® Count & Viability Assay Kit in a Muse Cell Analyser (Merck Millipore).
-
bioRxiv - Cancer Biology 2021Quote: ... the cells were fixed by 4% PFA and stained with warm TRAP staining solution (TRAP kit, Sigma-Aldrich, SLBW4002) for 10-30 min at 37°C27 ...
-
bioRxiv - Cell Biology 2021Quote: ... The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA immunoprecipitation (RIP) assays were performed using Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (EMD Millipore 17-700). HEK293T cells were plated on 15-cm dishes coated with poly-L-ornithine at a density of 4E4 cells/cm2 ...
-
bioRxiv - Cell Biology 2022Quote: ... ligation and amplification steps were all carried out according to manufacturer’s protocol (DuoLink PLA assay kit, #DUO92008, Sigma Aldrich). Primary antibodies used were rabbit anti-BAF (Abcam ...
-
bioRxiv - Immunology 2022Quote: ... Genomic DNA was extracted from PBMCs using the GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, USA).
-
bioRxiv - Developmental Biology 2022Quote: The concentration of triglycerides in Drosophila larvae was measured using the Triglyceride Quantification Colorimetric Kit from Sigma (Cat. # MAK266). Ten ...
-
bioRxiv - Cancer Biology 2022Quote: The viability of THP-1 cells was assessed for 24h using the Cell Proliferation Kit II (XTT) (Sigma-Aldrich) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... DNA was extracted from sub-cultured isolates (loop of colonies) using the GenElute Bacterial Genomic DNA Kit (Sigma-Aldrich) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Changes in the ADP/ATP ratio were measured using the ADP/ATP ratio assay kit purchased from Sigma-Aldrich which is based on a luciferin - luciferase assay ...
-
bioRxiv - Molecular Biology 2021Quote: Boyden chamber transwell migration assays were set-up according to the cell migration assay kit manufacturer’s instructions (Sigma #ECM507), with RAW264.7 macrophages seeded in the upper chamber (30,000 per chamber ...
-
bioRxiv - Microbiology 2021Quote: ... YFP-dsRNA was labeled using the fluorescein RNA Labeling Mix Kit following the manufacturer’s instructions (Sigma, St. Louis, MO). For confocal microscopy examination of fluorescent dsRNA uptake by fungal mycelium ...
-
bioRxiv - Immunology 2020Quote: ... Plasmids encoding the selected peptides were isolated in 96-well format using the Montage Plasmid MiniprepHTS Kit (MilliPore, LSKP09604) on a MultiscreenHTS Vacuum Manifold (MilliPore ...
-
bioRxiv - Neuroscience 2021Quote: ... Cytokines/chemokines were then quantified by multiplex immunoassay using a high sensitivity mouse multiplex magnetic bead kit (Millipore Sigma) and performed according to the manufacturer’s recommendations (MILLIPLEX MAP Mouse Cytokine/Chemokine Magnetic Bead Panel-Immunology Multiplex Assay ...
-
bioRxiv - Biochemistry 2020Quote: ... fixed and stained for β-galactosidase activity at pH = 6 using Senescence Cells Histochemical Staining Kit (Sigma, Cat#CS0030). For rescue assays ...
-
bioRxiv - Cell Biology 2021Quote: VCAM-1 in the media (1:100) from MCECs stimulated with MG was measured using commercial kits from Sigma, according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... Free fatty acids were measured by a colorimetric assay using the Free fatty acid quantification Kit (Sigma-Aldrich, #MAK044) following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: Plasma leptin levels were determined using a commercially available mouse leptin ELISA kit (EMD Millipore, St. Charles, MO, USA). The intra-assay variation of the kit was between 1.06-1.76% ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen tissue (from 2–3 mice or 1 rat) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... and growth factors were quantified in plasma using a 23-plex MAP NHP immunoassay kit (PCYTMG-40K-PX30, Millipore) following the manufacturer’s recommendations ...
-
bioRxiv - Pathology 2022Quote: ... The PLA was conducted according to the manufacturer’s instructions using the Duolink In Situ Red Starter Kit Mouse/Rabbit (Cat. No. DUO92101, SIGMA). After blocking for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Cell Counting Kit-8 (CA1210) and D-Luciferin (L6882) were all purchased from Sigma-Aldrich (Saint Louis, MO, USA). Lipofectamine2000 was purchased from Invitrogen (11668019 ...
-
bioRxiv - Immunology 2022Quote: RNA extraction of freshly isolated cells in BAL or detached AMs was performed using total RNA purification kit (Sigma) together with DNase I (invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: The ATPase activity of βγ-CAT was measured by an ATPase activity assay kit (Sigma-Aldrich, Cat MAK113-1KT) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The protein supernatants were collected after centrifugation at 30,000g at 4 °C for 30 min and then quantified using a 2D-quant kit (Sigma). For each diagnostic group ...
-
bioRxiv - Systems Biology 2019Quote: ... the recovered nuclear pellet was extracted as for broccoli nuclei using Nuclear Extraction Buffer (CelLytic PN kit, Sigma-Aldrich).
-
bioRxiv - Neuroscience 2019Quote: ... Samples of medium were collected after 3h and analyzed with a colorimetric glutamate assay kit (Sigma-Aldrich; MAK004-1KT), according to the manufacturer‘s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Further staining of primary antibody was performed following Dako envision plus kit and DAB staining (Anti-ITGA2, Sigma HPA063556). Hematoxolin and eosin staining was performed following dehydration of the tissue by incubation with increasing concentrations of alcohol ...
-
bioRxiv - Biochemistry 2019Quote: The medium of stimulated 3T3-L1 adipocytes was collected and glycerol content measured using a standard glycerol kit (Sigma). Cells were washed three times with 1xPBS and lysed by incubation with 0.3 M NaOH and 1% SDS ...
-
bioRxiv - Microbiology 2019Quote: ... each RNA sample was supplemented with 1 unit of DNase I (from the DNA amplification grade Kit of Sigma) per µg of RNA and incubated at room temperature for 10 min ...
-
bioRxiv - Pathology 2020Quote: ... Adiponectin was measured in the samples using MILLIPLEX Mouse Cytokine/Chemokine 1-plex kit (Millipore, St. Charles, MO, USA) according to the manufacturer’s protocol ...