Labshake search
Citations for Millipore Sigma :
6301 - 6350 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then washed 3 x 5 min in PBS and nuclei stained with Hoechst 3342 (10 µg/ml in PBS, Sigma) for 20 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Adult male and female worms were relaxed and separated by incubation (15 min) in a 0.25% solution of the anaesthetic ethyl 3-aminobenzoate methanesulphonate (Sigma-Aldrich) dissolved in DMEM ...
-
bioRxiv - Molecular Biology 2020Quote: ... The quality of nuclear and cytoplasmic extraction was validated by western blotting by α-Histone 3 (Sigma, St. Louis, MO) (1:2000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human bronchial epithelial cells (16HBEo-) were transduced with VSV-G pseudo-typed lentiviral particles in the presence of 3 μg/ml polybrene (Millipore). Expression vectors encoding the spike protein cDNA were directly transfected into 16HBEo− with Lipofectamine P3000 according to manufacturer’s recommendations (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were then washed 4x with Buffer A containing only 0.1% NP-40 and bound protein was eluted by 3 sequential incubations in PBS containing 0.1% triton x-100 (Sigma-Aldrich) and 0.5mg/ml of 3x FLAG peptide (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2022Quote: ... followed by buffer exchange (5 cycles of concentration to 0.5 ml volume and dilution with 5 ml buffer B) using a 3 kDa MWCO Amicon Ultra-15 centrifugal ultrafilter (Millipore), and the purified Alexa647-CAP was stored in aliquots at −80°C.
-
bioRxiv - Cell Biology 2022Quote: ... Arteries were then stimulated with increasing concentrations of serotonin (5-HT, from 10 -8 to 3· 10 -5 M, Sigma), endothelium-dependent vasodilator acetylcholine (ACh ...
-
Prom1 and Notch regulate ciliary length and dynamics in multiciliated cells of the airway epitheliumbioRxiv - Cell Biology 2022Quote: ... mTEC were cultured from ALI day -3 to ALI day 8 with an added gamma-secretase inhibitor (DAPT, 50 μM, Sigma) or vehicle control (DMSO ...
-
bioRxiv - Immunology 2022Quote: ... Plates were washed once with PBS containing 0.1% Tween 20 (PBS-T) and blocked with 3% bovine serum albumin (BSA, Sigma Aldrich) in PBS-T for 1 hr at room temperature ...
-
bioRxiv - Genomics 2020Quote: BJ cells (Fig. 3) and A549 cells (Fig. S10) were treated with 5 μg/mL of Actinomycin D (Sigma, A9415), which inhibits transcription by halting elongation of the transcribed RNA (42 ...
-
bioRxiv - Immunology 2021Quote: Blood was extracted from hBLT mice at 3 and 5-6 weeks post-infection and lysed with Red Blood Cell Lysis Buffer (SIGMA). T cells were activated for 1.5 h with 5μl/ml of anti-CD28 and anti-CD49d in the presence or absence of 6.4μg/ml of a Gag pool of peptides in the presence of 0.5μg/ml Brefeldin A ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 100 μL technical triplicates of tyrosinase-containing supernatants were incubated with 100 μl of 3 mg/mL L-DOPA solutions (Sigma) that were dissolved in 0.1 M phosphate buffer (pH 6.8 ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were concentrated by centrifugation at room temperature and seeded to derive respective primary cell cultures in MEM medium with 3% FBS (Sigma). The primary cell cultures were transduced with the fluorescent td tomato-/EGFP-luciferase fusion protein expressing lentiviral vectors for 18-24 hours ...
-
bioRxiv - Genetics 2020Quote: ... Samples were immunoprecipitated with antibodies (5-8 μg) overnight at 4°C followed by incubation for 3 hours with protein G-sepharose beads (Millipore) and washed sequentially ...
-
bioRxiv - Genetics 2020Quote: ... and precipitated with antibodies overnight at 4°C followed by incubation for 3 h with protein G Sepharose beads (Millipore). Normal mouse ...
-
bioRxiv - Plant Biology 2020Quote: ... plants were incubated overnight at 37°C in GUS buffer (3 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide [Duchefa Biochemie, Haarlem, The Netherlands], 0.1% v/v Triton X-100 [Sigma, Steinhaim ...
-
bioRxiv - Bioengineering 2020Quote: ... and spin-filtered to concentrate and remove impurities (14 krcf for 30 min; Amicon Ultra-0.5 mL centrifugal filters with 3 kDa MWCO, Millipore Sigma). Proteins were alkylated with 15 mM iodoacetamide for 30 min in the dark ...
-
bioRxiv - Bioengineering 2020Quote: ... CSF was concentrated 10X prior to the incubation step to maintain the same protein to nanoparticle ratios under volume constraints (14 krcf for 30 min; Amicon Ultra-0.5 mL centrifugal filters with 3 kDa MWCO, Millipore Sigma). The ratio of protein concentration to nanoparticle surface area was maintained constant for each respective nanoparticle type in different biofluids ...
-
bioRxiv - Physiology 2020Quote: ... ob-Acsl1H-/- and lean and obese Acsl1flox/flox littermate control mice were injected intraperitoneally with tamoxifen (3 mg/40 g of body weight) (Sigma) dissolved in corn oil (20 mg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... Tissues were processed and 3 μm deparaffinized sections were treated for 45 min with 0.5% (w/v) α-amylase (Sigma), rinsed for 30 min in water and processed for Periodic Acid Schiff (PAS ...
-
bioRxiv - Genetics 2021Quote: ... slides were incubated at room temperature for 10 min in 3% (v/v) stop/wash buffer (EMD Millipore; Part # 90419) to terminate the reaction and washed three times in 1× PBS for 5 min each ...
-
bioRxiv - Genomics 2021Quote: ... and sorting G1 cells based on Hoechst staining on a JAZZ FACS machine into 384 well plates containing 50 nl Wash buffer 3 (Wash buffer containing 0.05 % saponin) and 5 μl sterile filtered mineral oil (Sigma Aldrich) per well ...
-
bioRxiv - Genomics 2021Quote: ... into 384 well plates containing 50 nl Wash buffer 3 (Wash buffer containing 0.05 % Tween) and 5 μl sterile filtered mineral oil (Sigma Aldrich) per well ...
-
bioRxiv - Genetics 2020Quote: A 32P 5′-labeled 70-mer oligonucleotide [5′-42(T)-ATCTCAGCGATCTGTCTATTTCGTTCAT-3′] was hybridized to a single-stranded pBluescript SK(+) followed by one cycle of polymerization using KOD polymerase (Novagen) to produce a ∼3-kb double-stranded template with a preformed replication fork ...
-
bioRxiv - Biophysics 2021Quote: ... was also placed into 7 M Guanidium HCl using three successive concentrations and dilutions using a centrifugal concentrator (3 K MWCO, Amicon Ultra-4, Millipore), and diluted to 2 mg/mL ...
-
bioRxiv - Biophysics 2021Quote: ... Free dye was removed from the labeled proteins by successive concentrations and dilutions using a 3 K MWCO centrifugal concentrator (Amicon Ultra-4, Millipore). The labeling efficiency was computed by measuring the concentration of the protein and Cy3 dye using their absorbances at 280 nm and 550 nm ...
-
bioRxiv - Cancer Biology 2020Quote: ... lentiviral vectors expressing the shRNA targeting PAT4 were produced as follows: HEK293T cells were co-transfected with shRNA-PAT4 plasmid DNA (5’-CCGGCCTTGATAAATGAGCAGAATTCTCGAGAATTCTGCTCATTTATCAAGGTTT TTG-3’; TRCN0000043984; Sigma) or new shRNA lentivirus (GTTGTCCTTATTGGAGATTC ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pellets containing 3-5 million cells were prepared and frozen at −80°C in albumin/DMSO (90/10, Sigma-Aldrich). Note that the wild-type for both BRAF and NRAS (WT ...
-
bioRxiv - Neuroscience 2020Quote: ... from 6-week-old B6.Cg-Tg(Thy1-YFP)16Jrs/J male and female mice were plated on Transwell inserts (Grenier Thincerts, 3 μm porosity) coated with 10 μg/ml laminin (Sigma). Mitotic inhibitors ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 birds (henceforth SP-treated birds) had a daily subcutaneous injection of 30 µl of a sulfadoxine-pyrimethamine solution (Sigma S7821 and 46706 ...
-
bioRxiv - Microbiology 2021Quote: ... The hSPLUNC1 coding sequence with a 3’ sequence encoding the FLAG tag was amplified from cDNA using KOD polymerase (Sigma) and the primers (Forward ...
-
bioRxiv - Neuroscience 2020Quote: ... before being rehydrated in milliQ water for 3 min and incubated with preheated 0.3% black-gold II stain (Millipore, AG105) at 60°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Bound protein was eluted seven times with 0.5 column volumes of buffer A with 3 mM D-Desthiobiotin (Sigma-Aldrich), 0.026% DDM and 0.1 mM AEBSF protease inhibitor ...
-
bioRxiv - Bioengineering 2021Quote: ... we incubated them with suspended lentiviral solutions (MOI 3-5) for 24 h with 4 µg/mL polybrene (Sigma-Aldrich) before we replaced the medium with refresh culture medium ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were centrifuged again for 3 min at 300 rcf and blocked with staining buffer (FACS buffer containing 0.5% Tween20 (Sigma, P2287)) for 15 min at RT in the dark ...
-
bioRxiv - Biochemistry 2021Quote: ... were mixed with 3 µl proteinase K (20 mg/ml in 25 mM Tris-HCl, 5 mM Ca2Cl, pH 8.0, Sigma-Aldrich). This mixture was applied to the ear clips ...
-
bioRxiv - Biochemistry 2020Quote: ... The PLL-dye conjugates were purified by filtration through Amicon Ultra-0.5 mL centrifugal filters with a molecular weight cutoff (MWCO) of 3 kDa (Millipore Sigma). The final concentration of PLL was determined with a bicinchoninic acid (BCA ...
-
bioRxiv - Biophysics 2021Quote: Fractions were assessed by SDS-PAGE and pooled for dialysis in 3.5 kDa MWCO dialysis tubing (SpectraPor 3 Dialysis Membrane, Sigma Aldrich). For all variants except CLC ...
-
bioRxiv - Neuroscience 2021Quote: Synaptosomes were prepared from the striatum or cortex of VGLUT1venus or DAT-Cre eGFP-expressing mice by homogenization in 1ml of ice-cold isosmolar buffer (0.32M sucrose, 4 mM HEPES pH7.4, protease inhibitor cocktail Set 3 EDTA-free (EMD Millipore Corp.)) ...
-
Peripheral CB1 receptor blockade acts as a memory enhancer through an adrenergic-dependent mechanismbioRxiv - Neuroscience 2021Quote: Free-floating brain slices were rinsed in PB and blocked in a solution containing 3 % donkey serum (DS) (Sigma-Aldrich) and 0.3 % Triton X-100 (T ...
-
bioRxiv - Biochemistry 2021Quote: ... and 4) the substrate solution (nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate, Sigma-Aldrich, St. Louis, MO). Other details were as described previously [Duk M. ...
-
bioRxiv - Microbiology 2021Quote: ... The anterior portion was immediately placed into a HPF 3 mm specimen carrier with 20% bovine serum albumin (Sigma-Aldrich) and frozen in an Alba HPM 010 ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were hybridized overnight at 37°C with sixteen FLAP-Y-Cy-3 tagged complementary oligonucleotide probes, targeting regions in Cox7c mRNA (IDT) in Hybridization mix (15 % Formamide, 1.7 % tRNA (Sigma; R1753), 2 % FLAP:Probe mix ...
-
bioRxiv - Biophysics 2021Quote: D-glucose and 3-O-methyl-D-glucose powder for in vitro studies were obtained from Sigma-Aldrich (Milan, Italy). Solutions of D-glucose and 3OMG for in vitro studies were prepared in 10 mM phosphate-buffered saline (PBS 1X) ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a washout into thymidine free media for 3 hours prior to the addition of Taxol (250 nM; Sigma) for 15 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... SP cells lacking endogenous mRNA were resuspended (3×106 SP cells/mL as determined by trypan blue (Sigma-Aldrich, T8154) staining ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were further washed after 3 days and the medium changed to RPMI supplemented with 10% heat-inactivated human serum (Sigma). MDM were then infected 3-4 days later at low multiplicity of infection ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected with HIV-1NL4-3 or HIV-1JRFL (PM1-CCR5) and cultured in RPMI 1640 medium (Sigma-Aldrich) supplemented with 10% fetal calf serum (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... Complementation of the lasR-less phenotype was done in the presence and absence of 5 μM 3-Oxo-C12-HSL (Sigma) and pyoverdine ...