Labshake search
Citations for Addgene :
4251 - 4300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... a volume of 200 nL AAV2/5.hsyn.GcaMP6f.WPRE.SV40 virus or AAV2/5.syn.jGCaMP8s.WPRE (respectively: titer: 1.3*1012 gc/mL; a gift from Douglas Kim & GENIE Project: Addgene viral prep # 100837-AAV5 ...
-
bioRxiv - Neuroscience 2024Quote: ... a gift from Bryan Roth (Addgene viral prep # 50475-AAV5 ; http://n2t.net/addgene:50475 ; RRID:Addgene_50475) or AAV2/5-hsyn-mCherry (titer ...
-
bioRxiv - Neuroscience 2024Quote: ... Each coverslip was transfected with 1 μg of either GFP or HA-UBE3A plasmid (Addgene, cat. #8648), and 1 μL Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used pAAV-CW3SL-EGFP (Addgene plasmid #61463) as a backbone and replaced EGFP with PCR products that contained either mRuby3-2A-Cre-WPRE or mRuby3-2A-dCre-WPRE (the plasmids pAAV-Ef1a-fDIO-mRuby3-2A-Cre and pAAV-Ef1a-fDIO-mRuby3-2A-dCre respectively served as templates 28 ...
-
bioRxiv - Neuroscience 2024Quote: Mice were injected with AAV1-mDlx-GCaMP6f-Fishell-2 (titer: 4.43E13; developed in the lab of Gordon Fishell; purchased from Addgene: plasmid #83899 ...
-
bioRxiv - Neuroscience 2024Quote: ... Titer: 2 × 1012 virus molecules/ml) and placed a second microinjection of 200 nl of AAV8-hSyn-DIO-mCherry (Addgene, Catalog#50459-AAV8 ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected the lateral PB of these mice with 90 nL of conditional rabies virus (EnvA SADΔG-EGFP; Salk Institute, Addgene#32635, Titer: 2.26x108 TU/mL). We then perfused the mice 7 days later.
-
bioRxiv - Neuroscience 2024Quote: ... constructs to make lentivirus (pMD2.G and psPAX2) were gifts of Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... constructs to make lentivirus (pMD2.G and psPAX2) were gifts of Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... were gifts of Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259; Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260). ALFA and HA tagged LRRTM2 KDR variants for transient expression in HEK cells were generated by replacing the GFP tag in KDR GFP-LRRTM2 previously described8 using NEB HIFI Gibson cloning ...
-
bioRxiv - Neuroscience 2024Quote: ... we used a non-conditional tracing approach by injecting 100 nL of AAV9-CAG-hChR2-mCherry (Addgene, Catalog#100054-AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-hSyn-Con/Fon-eYFP (Addgene 55650) and rAAV2-EF1a-DIO-Flpo (Addgene 87306).
-
bioRxiv - Plant Biology 2024Quote: ... pAK002 (Addgene ID #128215), pAK-EL-02 (Addgene ID #125761 ...
-
bioRxiv - Plant Biology 2024Quote: ... pAK-EL-02 (Addgene ID #125761) and pFH66 (Addgene ID #131765 ...
-
bioRxiv - Plant Biology 2024Quote: ... pFH51 (Addgene ID #128213), pAK002 (Addgene ID #128215) ...
-
bioRxiv - Neuroscience 2024Quote: ... into a retrograde AAV helper vector (a gift from Alla Karpova & David Schaffer [Addgene plasmid # 81070; http://n2t.net/addgene:81070; RRID:Addgene_81070]) (Tervo et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSyn-EGFP (Addgene, 50465) was injected into the sensorimotor cortex at 14 dpi ...
-
bioRxiv - Physiology 2024Quote: ... and co-transfected with pMD2.G and psPAX2 (Addgene, plasmid # 12259 and 12260) into HEK293T cells to produce virus ...
-
bioRxiv - Physiology 2024Quote: ... a unilateral 250Lnl injection of AAV1-syn-FLEX-jGCaMP7s-WPRE (titer: 1L×L1012Lvg/ml, Addgene #104487-AAV1) was used to express GCAMP7s into Sup5Phox2b.
-
bioRxiv - Neuroscience 2024Quote: ... the USP14 entry clone from the human ORFeome collaboration library was used to perform mutagenesis and the constructs obtained were transferred into the 2Flag-pDEST-N (118371, Addgene, USA) vector using standard reaction protocol ...
-
bioRxiv - Neuroscience 2024Quote: USP14_Reverse: 5’ AAACCCAATGGTATTCAAGGCTCACC 3’ were cloned into pSpCas9(BB)-2A-Puro vector (PX459, 62988, Addgene, USA) using FastDigest BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2024Quote: ... Construct was subcloned in the pAAV.TBG.PI.Null.bGH (Addgene #105536) plasmid provided by the Vector Core at University of Pennsylvania ...
-
bioRxiv - Plant Biology 2024Quote: ... pICH47742 (Addgene ID #48001), pICH47751 (Addgene ID #48002 ...
-
bioRxiv - Plant Biology 2024Quote: ... and pICH41766 (Addgene ID #48018) were provided by Sylvestre Marillonnet (Leibniz Institute of Plant Biochemistry ...
-
bioRxiv - Plant Biology 2024Quote: ... pICH47751 (Addgene ID #48002) and pICH41766 (Addgene ID #48018 ...
-
bioRxiv - Neuroscience 2024Quote: ... A DNA mix containing the required plasmids (pMD2.G (#12259 Addgene), psPAX2 (#12260 Addgene) ...
-
bioRxiv - Neuroscience 2024Quote: ... a total of 0.6 µL of AAV5-Syn-GCaMP6s virus (1.8 × 1013 genome copies per mL, Addgene) was slowly injected by Nanoject III Nanoliter Injector into layer 2/3 motor cortex (1.5 mm anterior from bregma ...
-
bioRxiv - Neuroscience 2024Quote: The pAAV-hSyn-DIO-hM4D(Gi)-mCherry (DREADD virus) (4*10^12 gc/ml, Addgene, United States, addgene.org) or pAAV-hSyn-DIO-mCherry (4.2*10^12 gc/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were injected in LHA with AAV5-hSyn-DIO-eGFP (1*10^12vc/ml; Addgene) and co-injected with rAAV5-ORXpr1-3TdTomato (1*10^12 gc/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... We packaged pAAV-hSyn-eNpHR 3.0-EYFP (a gift from Karl Deisseroth [Addgene plasmid #26972; http://n2t.net/addgene:26972; RRID:Addgene_26972]) and pAAV-hSyn-EGFP (a gift from Bryan Roth [Addgene plasmid # 50465 ...
-
bioRxiv - Plant Biology 2024Quote: ... AtDJ-1C (without N-terminal signal sequence) and AtDJ-1E were cloned into a pRSF-duet vector (Addgene) for protein purification by using primers P5-P8 (Table 1).
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Markus Landthaler (Addgene plasmid # 97060 ...
-
bioRxiv - Microbiology 2024Quote: ... and p-VSVG (Addgene #138479). One day post- transfection ...
-
bioRxiv - Microbiology 2024Quote: ... with targeted LentiCrispr V2 plasmid (Addgene Plasmid #98290), pSPAX (Addgene #12260) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25μg of psPax2 (Addgene #12260) and 10μg of pMD2.G (Addgene #12259 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10μg of pMD2.G (Addgene #12259) were added to 3ml of Opti-MEM (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... an eGFP open reading frame was transferred from pDONR221- eGFP (Addgene #25899)37 into pInducer20 (Addgene #44012)38 using the Gateway LR Clonase II Enzyme Mix (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-FLEX-tdTomato and pAAV-FLEX-GFP viruses were used to confirm AAV-ENK-cre virus expression (purchased from Addgene, Catalog # 28306 and #28304 ...
-
bioRxiv - Molecular Biology 2024Quote: ... WTC-11 iPSCs were electroporated with the corresponding homology plasmid (3 µg per electroporation) and two TALEN plasmids (0.75 µg per electroporation each) targeting the AAVS1 locus (Addgene, #52341 and #52342). iPSCs were dissociated into a single cell suspension ...
-
bioRxiv - Molecular Biology 2024Quote: ... For the PEmax and PEmax-MLHdn1 plasmid the CRISPRi plasmid was used as a backbone while inserting the PEmax or PEmax-P2A-MLHdn1 (Addgene, #174828) sequences with the NEBuilder® HiFi DNA Assembly Master Mix ...
-
bioRxiv - Neuroscience 2024Quote: ... a vector eGFP-pWPT (Addgene #12255, kind gift from D. Trono) was used to express eGFP and a home-made vector containing LifeAct-RFP – IRES - EB3-YFP were used to express both LifeAct-RFP and EB3-YFP ...
-
bioRxiv - Neuroscience 2024Quote: ... human TDP-43 was subcloned out of a wtTDP-43tdTOMATOHA (gift from Zoushang Xu, Addgene # 28205) via XhoI and Kpn1 double digest and inserted into a pEGFP-N3 (Clontech ...
-
bioRxiv - Neuroscience 2024Quote: ... we amplified the FLP ORF from pCAG-Flpo (a gift from Dr. Massimo Scanziani; Addgene plasmid # 60662) with a AgeI restriction site on the 5’ end ...
-
bioRxiv - Neuroscience 2024Quote: A bicistronic virus expressing both opsin and GCaMP indicator, AAV9-hSyn-DIO-jGCaMP8s-P2A-stChrimsonR(LaFosse et al., 2023) (Addgene, 174007) was diluted in phosphate-buffered saline (final titer ...
-
bioRxiv - Neuroscience 2024Quote: ... The CBh promoter was isolated from pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Dr. Feng Zhang; Addgene plasmid # 42230) by digestion of the KpnI and AgeI restriction sites and inserted into the KpnI/AgeI restriction sites of the pAAV-EF1a-F-FLEX-mNaChBac-T2A-tdTomato backbone ...
-
bioRxiv - Neuroscience 2024Quote: CBh-eGTACR1-mScarlet was generated by inserting KpnI and AgeI restriction sites flanking EF1a in the pAAV-EF1a-F-FLEX-mNaChBac-T2A-tdTomato (a gift from Dr. Massimo Scanziani; Addgene plasmid # 60658) through pcr cloning ...
-
bioRxiv - Neuroscience 2024Quote: ... USA (pAAV5-CaMKIIa-hM4D(Gi)-mCherry and pAAV5-CaMKIIa-hM3D(Gq)-mCherry were gifted from Bryan Roth (Addgene viral prep # 50477and # 50476 ...
-
bioRxiv - Neuroscience 2024Quote: ... we isolated mScarlet from pmScarlet_C1 (a gift from Dr. Dorus Gadella; Addgene plasmid # 85042) through pcr amplification ...
-
bioRxiv - Neuroscience 2024Quote: ... but now obtained from Addgene, USA (pAAV5-CaMKIIa-hM4D(Gi)-mCherry and pAAV5-CaMKIIa-hM3D(Gq)-mCherry were gifted from Bryan Roth (Addgene viral prep # 50477and # 50476 ...
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290) (Gohl et al. ...