Labshake search
Citations for Addgene :
4201 - 4250 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and the Dendra2 coding sequence was inserted to serve as the template for DNA integration (Addgene stock TBD). One-cell stage embryos obtained by natural crosses of Casper/Casper adults were co-injected with an injection mix including 150 ng/ µL of TALEN mRNA and 12 ng/µL of donor plasmid (Fig ...
-
bioRxiv - Developmental Biology 2024Quote: In-frame integration of Dendra2 into the C-terminus of apoBb.1 was achieved using TALENs as previously described and validated (56) (Addgene stock 128695 and 128696). TALENs were in vitro transcribed using the T3 Message Machine Kit (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... Target sequences were cloned into pU6-BbsI-chiRNA (Gratz et al., 2013; Addgene Plasmid 45946). The resulting plasmids were injected with or without donor plasmid into vasa-Cas9 expressing embryos (Sebo et al. ...
-
bioRxiv - Genetics 2024Quote: ... a 3XFLAG-NatMX cassette was PCR-amplified from pYC46 plasmid (Addgene) and inserted at the C-terminus of ZCF27 and ZCF4 (74 ...
-
bioRxiv - Genetics 2024Quote: ... and 3’ UTR was PCR-amplified and cloned into the pGRB2.0 plasmid (Addgene) (73 ...
-
bioRxiv - Genetics 2024Quote: ... p415-GalL-Cas9-CYC1t (Addgene plasmid #:107922; MSp6) and transformants were selected on CSM -Ura -Leu glucose plates ...
-
bioRxiv - Genetics 2024Quote: ... a HIS3 SpCas9 gRNA plasmid acquired from Jean-Marc Daran (Addgene plasmid #:107922). For cloning in the repair templates ...
-
bioRxiv - Genetics 2024Quote: ... is a functional plasmid that was used as a basis for the recombination experiments (plasmid available at Addgene). Two modifications of this plasmid—a truncation to create a 5758bp plasmid p-att-ef1a-MS2-RecT-dCas9-BSD-truncated and an extension to create a 13942bp plasmid p-att-ef1a-MS2-RecT-dCas9-BSD-extended —were used for recombination experiments but are not intended to be functional for genome editing ...
-
bioRxiv - Immunology 2024Quote: 293T cells were seeded in 6-well plates and transfected with the prISG15-Renilla-hPEST-IRES-Puro construct together with psPAX2 and pMD2.G (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Immunology 2024Quote: ... and the hPEST sequence was PCR amplified from plasmid pcDNA3.1(+)GUG-nLuc-3XFLAG-CL1/PEST (Addgene plasmid #127317 ...
-
bioRxiv - Immunology 2024Quote: eGFP as control or SMARCA4 were cloned into the pInducer20 doxycycline inducible lentiviral vector (Addgene 44012). Lentivirus was produced using standard virus production methods by co-transfecting target and packaging plasmids (psPAX2 – Addgene12260 and pMD2.G-Addgene 12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa Cas9 cells were generated with the lentiCas9-Blast plasmid 87 (Addgene plasmid #52962 ...
-
bioRxiv - Cell Biology 2024Quote: ... reporter cell lines were transfected with pCBASce (Addgene plasmid #26477; http://n2t.net/addgene:26477; RRID: Addgene_26477, a gift from Maria Jasin) plasmid using Lipofectamine 3000 according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... reporter cell lines were transfected with pCBASce (Addgene plasmid #26477 ...
-
bioRxiv - Cell Biology 2024Quote: The DSB repair reporter vectors pDRGFP (Addgene plasmid #26475; http://n2t.net/addgene:26475; RRID: Addgene_26475) and hprtSAGFP (Addgene plasmid #41594 ...
-
bioRxiv - Cell Biology 2024Quote: ... and hprtSAGFP (Addgene plasmid #41594; http://n2t.net/addgene:41594; RRID: Addgene_41594), were a gift from Maria Jasin ...
-
bioRxiv - Cell Biology 2024Quote: The DSB repair reporter vectors pDRGFP (Addgene plasmid #26475 ...
-
bioRxiv - Cell Biology 2024Quote: ... Reporter cells were transfected in parallel with pCAGGS-mCherry (a gift from Phil Sharp; Addgene plasmid #41583 ...
-
bioRxiv - Cell Biology 2024Quote: ... Reporter cells were transfected in parallel with pCAGGS-mCherry (a gift from Phil Sharp; Addgene plasmid #41583; http://n2t.net/addgene:41583; RRID: Addgene_41583) as an internal control to estimate transfection efficiency and calculate relative DSB repair activity ...
-
bioRxiv - Cell Biology 2024Quote: ... and hprtSAGFP (Addgene plasmid #41594 ...
-
bioRxiv - Cell Biology 2024Quote: The plasmid EF1a-mito-dsRED2 was a gift from Thomas Schwarz (Addgene plasmid # 174541 ...
-
bioRxiv - Cell Biology 2024Quote: The plasmid EF1a-mito-dsRED2 was a gift from Thomas Schwarz (Addgene plasmid # 174541; http://n2t.net/addgene:174541; RRID:Addgene_174541). It contains a Flex-Switch-MitoDsRed construct under the transcriptional control of the EF-1α promoter ...
-
bioRxiv - Cell Biology 2024Quote: ... were constructed by inserting annealed synthetic oligomers (5′-CACCgcagctcctgcctctcatcg-3′ and 5′-AAACcgatgagaggcaggagctgc-3′) into the Bbs I site of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene, Watertown ...
-
bioRxiv - Cell Biology 2024Quote: ... The iRFP670 sequence was cloned into pNLS-iRFP670 (#45466; Addgene) (Shcherbakova and Verkhusha ...
-
bioRxiv - Cell Biology 2024Quote: GCaMP6s (Addgene plasmid #40753(53)) binds Ca2+ with peak emission at 510 nm when excited at 480 nm.(53 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and guide RNAs were cloned into plasmid pCFD3-dU6:3 (for Dlp, Mad and Med) or pCFD4-U6:1_U6:3 (for Babo, Brk, Dad, Sax, Shn, Smad2 and Wit) (Addgene #49410 and #49411, (Port et al., 2014)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR-amplified homology arms were cloned into the pHD-dsRed-attP reintegration vector (Addgene #51019 (Gratz et al., 2014)) and guide RNAs were cloned into plasmid pCFD3-dU6:3 (for Dlp ...
-
bioRxiv - Cell Biology 2024Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ; http://n2t.net/addgene:62988 ; RRID:Addgene_62988 (56). WT iPSC cells were transfected with both guide RNA vectors using Lipofectamine 2000 (Thermofisher 11668019) ...
-
bioRxiv - Cell Biology 2024Quote: ... VSV.G (Addgene #14888), and transfer plasmids in a 45:5:50 ratio using PolyFect transfection reagent (Qiagen #301107 ...
-
bioRxiv - Cell Biology 2024Quote: Stable Cas9-expressing Pa03c cells were transduced with lentiCas9-Blast (Addgene #52962) lentivirus ...
-
bioRxiv - Cell Biology 2024Quote: HEK293T cells were co-transfected with psPAX2 (Addgene #12260), VSV.G (Addgene #14888) ...
-
bioRxiv - Genomics 2024Quote: ATF4 reporter Viral particles were made from pSMALB-ATF4.5 vector (a gift from John Dick & Peter van Galen; Addgene plasmid # 155032 ...
-
bioRxiv - Immunology 2024Quote: Stable Cas9 expression was established in human B-cell lines (WSU-FSCCL, HBL-1 and SUDHL5) using lentiviral transduction of lentiCas9-Blast (Addgene #52962). Cells were incubated with 10µg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Genomics 2024Quote: The FUGW plasmid (Addgene #14883) was used for the generation of the L-cells expressing eGFP ...
-
bioRxiv - Genomics 2024Quote: ... ph7SK-gRNA (Addgene #53189); pmU6-gRNA (Addgene # 53187) ...
-
bioRxiv - Genomics 2024Quote: ... dAsCas12a and dEnAsCas12a were derived from Addgene plasmids (114078 and 107943 ...
-
bioRxiv - Cell Biology 2024Quote: ... pEGFP-ACTN1 (Addgene #11908) was obtained from Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... psPAX2 (Addgene, #12260), and pMD2.G (Addgene ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene, 71814), 500 ng gRNA plasmid ...
-
bioRxiv - Cell Biology 2024Quote: Broad Institute gRNA sequences for MCU (TGAACTGACAGCGTTCACGC) and EMRE (GTCTCAGCCAGGTACCGTCG) were each cloned into the pU6T7 vector (Addgene, 71462). 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... and 17.5 μg pUC19 plasmid (Addgene, 50005). The cells and DNA were transferred to a cuvette ...
-
bioRxiv - Microbiology 2024Quote: GECs were transfected with 1 µg of pFLAG-CMV2-Hsp27-S78D/S82D (Addgene plasmid # 85187 [69]), a constitutively activated HSp27 construct ...
-
bioRxiv - Neuroscience 2024Quote: ... and pCAG-T7pol (Addgene #59926) for the rescue step 150 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 100 ng of pBABE puro plasmid (Addgene plasmid #1764 ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... and DPP4 (Addgene #158452) was used ...
-
bioRxiv - Genomics 2024Quote: ... pRDA_052 (Addgene 136474)45 was used for AsCas12a and an FUGW plasmid was used for LbCas12a ...
-
bioRxiv - Immunology 2024Quote: ... and 3.5 ug of PmD2.G (Addgene, Cat #12259) using Lipofectamine 2000 transfection reagent (Invitrogen cat # 11668019) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Pegl-20::mCherry::PH was constructed by Gibson assembly using Pwrt-2::gfp::PH (Wildwater et al., 2011) and pCFJ104 (Frøkjaer-Jensen et al., 2008) (a gift from Erik Jorgensen (Addgene plasmid # 19328 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2008) (a gift from Erik Jorgensen (Addgene plasmid # 19328; http://n2t.net/addgene:19328; RRID:Addgene_19328)) as PCR templates to amplify PH domain and mCherry ...