Labshake search
Citations for Addgene :
4001 - 4050 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Gpr158fl/fl:Plcxd2+/+ and Gpr158fl/fl:Plcxd2fl/fl pups were injected with 50nL of a mixture containing AAV-TRE- Cre (Addgene #69136) and AAV-SYN-DIO-GFP-IRES-tTA (Addgene #85006 ...
-
bioRxiv - Evolutionary Biology 2024Quote: Coding sequences for human RIPK1 (Addgene #78834), human RIPK2 (ORFeome ID #4886) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... were assembled using gene sequences ordered from IDT (gBlocks) and plasmid backbones (ordered from Addgene or derived from an existing Addgene plasmid) using the NEB Gibson Assembly Master Mix (#E2611) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... All plasmids generated in this study (with the exception of pWM17) were assembled using gene sequences ordered from IDT (gBlocks) and plasmid backbones (ordered from Addgene or derived from an existing Addgene plasmid ...
-
bioRxiv - Immunology 2024Quote: ... Two BA.5 NTD DMS libraries were further assembled into pETcon 2649 vector (Addgene) and electroporated into electrocompetent DH10B cells for plasmid amplification ...
-
bioRxiv - Systems Biology 2024Quote: ... cells were transfected with a pCMV-Grx1roGFP2-Hygromycin vector then the stable cell lines were selected with hygromycin B (the vector was modified from pEIGW-Grx1-roGFP2, 64990, Addgene). The information obtained from Grx1-roGFP2 fluorescence is not utilized in this work.
-
bioRxiv - Systems Biology 2024Quote: ... All mutual repression circuits were obtained from the pECJ3 plasmid (gift from Dr. James Collins, Addgene plasmid # 75465)21 and harbored in a plasmid with a ColE1 origin ...
-
bioRxiv - Synthetic Biology 2024Quote: A GFP-based fluorescent cAMP biosensor was made by cloning G-Flamp2 from Addgene plasmid # 19278242 and cloning into the pCDH lentivirus backbone.
-
bioRxiv - Synthetic Biology 2024Quote: A GFP-based fluorescent calcium biosensor was made by cloning GCaMP6s from Addgene plasmid #4075341 and cloning into the pCDH lentivirus backbone ...
-
bioRxiv - Synthetic Biology 2024Quote: An mCherry-based fluorescent DAG biosensor was made by C-terminally tagging mCherry to the C1PKCγ from Addgene plasmid #2120540 and cloning into the pCDH lentivirus backbone ...
-
bioRxiv - Molecular Biology 2024Quote: ... Drug cassettes were excised following each allele knockout via transient expression of Cre recombinase from pLEW100Cre_del_tetO (Addgene plasmid 24019 ...
-
ATP-dependent citrate lyase Drives Left Ventricular Dysfunction by Metabolic Remodeling of the HeartbioRxiv - Molecular Biology 2024Quote: ... which contains a gRNA scaffold and SpCas9 (Plasmid #48183, Addgene, Watertown, MA). A surveyor assay was used for testing the activity of gRNA according to the manufacturer’s instructions (Cat#1075931 ...
-
ATP-dependent citrate lyase Drives Left Ventricular Dysfunction by Metabolic Remodeling of the HeartbioRxiv - Molecular Biology 2024Quote: ... The first gRNA was cloned into the 1179_pAAV-U6-BbsI-gRNA-CB-EmGFP backbone (Plasmid#89060, Addgene, Watertown, MA; RRID:Addgene_89060) using BbsI cloning sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... obtained from Shinya Yamanaka (Addgene plasmid # 13459; http://n2t.net/addgene:13459; RRID:Addgene_13459) (Maruyama et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The ho1-pcy gene was derived from the pNO286-3 plasmid (Addgene #107746) that was deposited by Ong et al.59 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Gentamicin-R and Kanamycin-R) were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli MDS42 as wild-type and Ec_Syn61 (Addgene #174513) as a 61-codon variant of E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the pCAG promoter was replaced with 4xHRE_YB TATA for hypoxia recording (Addgene #117399)64 or 7xTCF/LEF for Wnt recording (Addgene #12456)65 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The Mammalian Toolkit was a gift from Hana El-Samad (Addgene kit #1000000180). For continuous propagation of cells containing the CHYRON locus ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 11.1 µg of a Cas9-expressing plasmid (Addgene #41815)69 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... an oxygen-dependent degron from one of our previously described plasmids (Addgene #132667)36 was appended to Cas9 in the hypoxia-recording cassette ...
-
bioRxiv - Molecular Biology 2024Quote: We adopted the CRISPR-Cas9 protocol according to manufacturer protocols (Addgene). Briefly ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The TdT gene was cloned into a pET28a expression vector (Addgene #69864-3) with an N-terminal 10xHis tag ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The plasmid for heterologous expression with alcohol inducible promoters pYFAC-CH2-ubi-Y-pyrG (Addgene ID# 221131) and pYFAC-CH2-ubi-M-pyrG (Addgene ID# 221132 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... C0000: pMOD_C0000 (#91081, Addgene) for CRISPR knockout and activation systems in plants ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PgpdA-mCherry expression cassette was amplified from pRecomb-loxP-mCherry-4Gcloningsite-lox2272-66 (Addgene ID# 168787). The gRNA expression cassette was amplified from pCRI040 which contains four Cas12a crRNAs targeting upstream of micA (Roux et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... T7 terminator and RBS were first amplified from the plasmid Ubiquitin WT16 (Cat#12647, Addgene) and added to pgRNA-bacteria7 using Golden gate cloning17 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... D100: pTRANS_100 (#91198, Addgene) for protoplast system ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and pYFAC-CH2-ubi-M-pyrG (Addgene ID# 221132) incorporate the four-promoter expression cassette from pYFAC-CH2 (Addgene ID #168978 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... incorporate the four-promoter expression cassette from pYFAC-CH2 (Addgene ID #168978) (Hu et al. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmids pYFAC-ubi-Y-pyrG (Addgene ID# 184497), pYFAC-ubi-M-pyrG (Addgene ID# 184498 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... A3701: pMOD_A3701 (#91052, Addgene) for CRISPR activation system in N ...
-
bioRxiv - Synthetic Biology 2024Quote: ... A4110: pMOD_A4110 (#91056, Addgene) CRISPR activation system in maize ...
-
bioRxiv - Synthetic Biology 2024Quote: ... a gift from Christopher Voigt (Addgene Kit #1000000137), were utilized in this study as PCR templates and/or intermediate DNA assembly hosts (19).
-
bioRxiv - Synthetic Biology 2024Quote: ... were made electrocompetent using our standard protocol2 and electroporated with pORTMAGE-2 (Addgene plasmid # 72677; http://n2t.net/addgene:72677; RRID:Addgene_72677) or alternatively ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The cumate-inducible system cassette was amplified from plasmid pCT5-bac2.0 (Addgene, #119872 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... a constitutively expressed chloramphenicol resistance marker and SpCas9 and tracrRNA (from pCas940,105, Addgene #42876). The complete sequence of pRedCas2 is available in Supplementary Data 1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and bet (from pORTMAGE-363, Addgene plasmid # 72678; http://n2t.net/addgene:72678; RRID:Addgene_72678), a p15A origin-of-replication ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 16 ng pRL-SV40P (Addgene #27163) per well using lipofectamine 3000 (Thermo Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... psPAX2 (a gift from Didier Trono; Addgene_12260), and pMD2.G (a gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2024Quote: The pooled genome-wide CRISPR knockout library (Addgene, #1000000132) was kindly provided by Prof ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected for 6 hours with 80 ng 3xERRE-ERE-luciferase containing codon-modified firefly luciferase (Addgene #37852) and 16 ng pRL-SV40P (Addgene #27163 ...
-
bioRxiv - Cancer Biology 2024Quote: ... We then extracted the corresponding sgRNA sequences and annotations for these genes from the Human CRISPR Knockout Library H3 (contributed by Profs. X. Shirley Liu and Myles Brown, Addgene pooled library #133914). On average ...
-
bioRxiv - Cancer Biology 2024Quote: For RNF2 knock-out we used pLKO5.sgRNA.EFS.GFP (Addgene, 57822) vector targeting the following sequences ...
-
bioRxiv - Systems Biology 2024Quote: ... and the corresponding sgRNA sequence (GTGCGAGTAGAAAACGTTAA) was cloned into the pX459 plasmid (Addgene #62988) using BbsI Golden Gate cloning ...
-
bioRxiv - Cancer Biology 2024Quote: Two independent sgRNAs (Supplementary Table 6) were designed for each target gene and cloned into lentiCRISPRv2-blast vector (Addgene #83480) or lentiCRISPRv2-puro vector (Addgene #52961 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or lentiCRISPRv2-puro vector (Addgene #52961) which expresses Cas9 and sgRNA simultaneously once transduced into target cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... we first replaced Puromycin with a Blasticidin resistance marker in LT3GEPIR (Addgene plasmid # 111177), a gift from Johannes Zuber (11) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The latter targeting vectors were cloned by linearizing cTGME shPten (Addgene plasmid #135667) (14 ...
-
bioRxiv - Systems Biology 2024Quote: ... Lentiviral constructs of either RGEDI2 or pHR-hSyn:EGFP (Addgene #114215)3 were added to the cell suspension at 5 MOI at the time of passage and removed after 48 hours ...