Labshake search
Citations for Addgene :
3851 - 3900 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Conditions included 45 ng PPRE luciferase (a gift from Bruce Spiegelman; Addgene plasmid #1015) and 5 ng renilla control reporter vector (Promega) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sequence GCTGAAAAGCCCTAGAGGCA was inserted into pDD162 vector for sgRNA expression (Dickinson et al., 2013) (pDD162 was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2024Quote: ... and pLL7.0:hITSN1(1159-1509)- tgRFPt-SspB (Addgene #60419 a gift from Prof. Brian Kuhlman), respectively(Guntas et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Gli2-GFP (Addgene plasmid #37672), 5HT6-G-GECO (Addgene plasmid #47499) ...
-
bioRxiv - Cell Biology 2024Quote: ... pLenti-PGK-EGFP-FLAG was cloned by inserting EGFP-FLAG (amplified from pCDH-CMV-eGFP-FLAG) to SalI and BsrGI-digested pLenti.PGK.blast-Renilla_Luciferase (Addgene 74444).
-
bioRxiv - Cell Biology 2024Quote: ... pGEM-Heh_bPAC-myc (Addgene plasmid #28134 gift from Peter Hegemann ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLenti CMV rtTA3 Hygro (Addgene plasmid, Cat. No. 26730) was used to generate Dox-inducible cell lines.
-
bioRxiv - Cancer Biology 2024Quote: ... the envelope plasmid pMD2.G (Addgene, Cat#12259, RRID: Addgene_12259), and the packaging plasmid psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... GFP and YAP5SA coding sequences were subclone into pTet-O-Ngn2-puro (Addgene plasmid, Cat. No 52047) to generate Tet-O-GFP and Tet-O-YAP5SA ...
-
bioRxiv - Cancer Biology 2024Quote: ... For co-transfection of NT-3 cells with siRNAs and RINS1 plasmid (gift from Dmytro Yushchenko, Addgene plasmid # 107290 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and the amplicons were then ligated into a pAc5-STABLE2-neo (Addgene, 32426) [61] digested with EcoRI/XhoI by In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with 900 ng psPAX2 (psPAX2 was a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID:Addgene_12260)) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1μg of pDEST-CMV mCherry-GFP-LC3B WT (Addgene plasmid # 123230; http://n2t.net/addgene:123230; RRID:Addgene_123230, Agrotis & Ketteler)30 per well using X-tremeGene HP (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with 900 ng psPAX2 (psPAX2 was a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral construct UT4GEPIR (Addgene #186712) was used for cloning Dox-inducible Ascl1 and mScarlet constructs ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1μg of pDEST-CMV mCherry-GFP-LC3B WT (Addgene plasmid # 123230 ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 ng pMD2.G (pMD2.G was a gift from Didier Trono (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259)) and 1μg of pDEST-CMV mCherry-GFP-LC3B WT (Addgene plasmid # 123230 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2013) (pDD162 was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLARRY-EGFP was a gift from Fernando Camargo (Addgene plasmid 140025). pmScarlet_NES_C1 was a gift from Dorus Gadella ...
-
bioRxiv - Biophysics 2024Quote: ... the HECT domain consisting of residues 615-994 of full-length NEDD4-2 (a gift from Joan Massague, Addgene plasmid # 27000) (66 ...
-
bioRxiv - Cancer Biology 2024Quote: ... we utilized the pLenti-CMV-TetR-blastR construct (Addgene cat. 17492). Both pLenti-CMV/TO-AXL-puroR and pLenti-CMV-TetR-blastR constructs were independently packaged into lentiviral particles ...
-
bioRxiv - Cell Biology 2024Quote: ... Myo19-GFP (Addgene 134988) was a gift from Martin Bähler (64) ...
-
bioRxiv - Cell Biology 2024Quote: ... The sequences were subsequently cloned in the destination vector MAC-tag-C, a gift from Markku Varjosalo (Liu et al., 2018) (Addgene plasmid # 108077 ...
-
bioRxiv - Cancer Biology 2024Quote: sgRNA sequences were designed using CRISPick38,39 and cloned into pSpCas9(BB)-2A-GFP (PX458) (Addgene, #48138). A549 cells were transfected with these vectors using Lipofectamine 2000 transfection reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... The sequences were subsequently cloned in the destination vector MAC-tag-C, a gift from Markku Varjosalo (Liu et al., 2018) (Addgene plasmid # 108077; http://n2t.net/addgene:108077; RRID:Addgene_108077), using the Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... Entry vector for: mito-roGFP2-Orp1 H2O2 oxidation sensor (mitochondrial), a gift from Adam Cohen (Werley et al., 2020) (Addgene plasmid # 163076 ...
-
bioRxiv - Cell Biology 2024Quote: ... Alice Ting (Han et al., 2017) (Addgene plasmid # 129705 ...
-
bioRxiv - Cell Biology 2024Quote: ... mRFP-FKBP from Tamas Balla (Addgene plasmid #67514); Reticulon 4-GFP and GFP-Climp63 from J ...
-
bioRxiv - Cell Biology 2024Quote: ... Schirmer (Addgene plasmid #62008); mRFP-FKBP from Tamas Balla (Addgene plasmid #67514) ...
-
bioRxiv - Cell Biology 2024Quote: ... Hell (Addgene plasmid #52669); EGFP-MyosinIIA from M ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 × 106 cells were plated in 60 mm dishes for 24 hours followed by transfection with m6A-Tracer GFP (AddGene, 139403) and DAM-lamin B1 (AddGene ...
-
bioRxiv - Cell Biology 2024Quote: ... Intracellular H2O2 was assessed using cells transiently transfected with cytosol-targeted pCS2+HyPer7-NES (Addgene #136467). Fluorescence ratios Ex490/Ex405nm and Em 535 were obtained every 30s for 30min using the Synergy Neo2 plate reader ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmid was made by replacing mTagBFP2 in plasmid #44899 from AddGene (Lee et al, 2013) with TEF2pr-Su9MTS-mCherry and the KanMX with MetR from pSD-N21 (Weill et al ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 ng pMD2.G (pMD2.G was a gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2024Quote: pMRX-IP/Venus-mULK1 was a gift from Noboru Mizushima (Addgene plasmid #58743 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pCVL SFFV d14GFP EF1s HA.NLS.Sce(opt) (cat #31476) were obtained from Addgene. Purified plasmids were transfected into HEK293 cells along with two lentiviral packaging plasmids ...
-
bioRxiv - Cancer Biology 2024Quote: ... and psPAX2 (Addgene #12260), by using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... pCMV-VSVG (Addgene #8454) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (Addgene plasmid # 12259) were a gift from Didier Trono.
-
bioRxiv - Cancer Biology 2024Quote: ... was cloned into MSCV-IRES-KSR1-RFP and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene #8449) and CMV5-VSVG envelope construct (Addgene #8454) ...
-
bioRxiv - Cancer Biology 2024Quote: Murine KSR1 (resistant to degradation by sgRNA sequences targeting human KSR1) was cloned into MSCV-IRES-KSR1-RFP (Addgene #33337) and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene #8449 ...
-
bioRxiv - Cell Biology 2024Quote: HSP90B1 constructs: pDONR223_HSP90B1_WT was purchased from Addgene (Plasmid #82130) and Gibson assembly was used to insert a 3xFLAG tag just after the ER signal sequence ...
-
bioRxiv - Cell Biology 2024Quote: Circadian clock gene activity was recorded with a Bmal1:luc reporter (Addgene 68833, a gift from Steven Brown) and a Per2:luc reporter (Addgene 212035 ...
-
bioRxiv - Cell Biology 2024Quote: ... Packaging plasmids pMD2G and psPAX2 (Addgene 12259 and 12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... 700,000 HEK293T cells were seeded onto a 6-well plate and 24 hours later transfected with 200 ng pMD2.G (Addgene), 400 ng psPAX2 (Addgene) ...
-
bioRxiv - Cell Biology 2024Quote: ... two independent guides were designed and individually cloned into lentiCRISPR v2 plasmid (Addgene #52961) (77) ...
-
bioRxiv - Cell Biology 2024Quote: ... consists of the backbone of the Bmal1:luc reporter vector (pLV6-Bmal-luc) and a murine Per2 promoter with adjacent luciferase sequence which is contained in the pGL3 basic E2 vector (Addgene 48747, a gift from Joseph Takahashi). The QuickChange Lightning Site-Directed Mutagenesis (SDM ...
-
bioRxiv - Cell Biology 2024Quote: ... 400 ng psPAX2 (Addgene), and 800 ng of the desired pLenti CMV Puro DEST or pLenti-TRE-rtta3G-BLAST construct using 7 μl of 1mg/ml polyethylenimine (PEI ...
-
bioRxiv - Cancer Biology 2024Quote: ... and TdTomato (FUtdTW virus; Addgene #22478) were purified by fluorescence-activated cell sorting (FACS ...
-
bioRxiv - Cancer Biology 2024Quote: ... pMD2.G (Addgene #12259), and pUMVC (Addgene #8449 ...