Labshake search
Citations for Addgene :
3351 - 3400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... Construct was subcloned in the pAAV.TBG.PI.Null.bGH (Addgene #105536) plasmid provided by the Vector Core at University of Pennsylvania ...
-
bioRxiv - Neuroscience 2024Quote: Mice were injected with AAV1-mDlx-GCaMP6f-Fishell-2 (titer: 4.43E13; developed in the lab of Gordon Fishell; purchased from Addgene: plasmid #83899 ...
-
bioRxiv - Neuroscience 2024Quote: ... Titer: 2 × 1012 virus molecules/ml) and placed a second microinjection of 200 nl of AAV8-hSyn-DIO-mCherry (Addgene, Catalog#50459-AAV8 ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected the lateral PB of these mice with 90 nL of conditional rabies virus (EnvA SADΔG-EGFP; Salk Institute, Addgene#32635, Titer: 2.26x108 TU/mL). We then perfused the mice 7 days later.
-
bioRxiv - Neuroscience 2024Quote: ... constructs to make lentivirus (pMD2.G and psPAX2) were gifts of Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-Syn-flex-ChrimsonR-tdT (Addgene 62723), AAV5-hSyn-DIO-hm4D31 (Gi)-mCherry (Addgene 44362) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-hSyn-DIO-hm4D31 (Gi)-mCherry (Addgene 44362), AAV5-CAG-flex-tdTomato (a gift from S ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-hSyn-eGFP (Addgene 50465-AAV5), AAV5-Syn-flex-ChrimsonR-tdT (Addgene 62723) ...
-
bioRxiv - Neuroscience 2024Quote: GFP-fused AR was cut from pEGFP-C1-AR plasmid (Addgene, cat. #28235) and inserted into the pFUW lentiviral (LV ...
-
bioRxiv - Neuroscience 2024Quote: ... a volume of 200 nL AAV2/5.hsyn.GcaMP6f.WPRE.SV40 virus or AAV2/5.syn.jGCaMP8s.WPRE (respectively: titer: 1.3*1012 gc/mL; a gift from Douglas Kim & GENIE Project: Addgene viral prep # 100837-AAV5 ...
-
bioRxiv - Neuroscience 2024Quote: ... a gift from Bryan Roth (Addgene viral prep # 50475-AAV5 ; http://n2t.net/addgene:50475 ; RRID:Addgene_50475) or AAV2/5-hsyn-mCherry (titer ...
-
bioRxiv - Neuroscience 2024Quote: ... Each coverslip was transfected with 1 μg of either GFP or HA-UBE3A plasmid (Addgene, cat. #8648), and 1 μL Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used pAAV-CW3SL-EGFP (Addgene plasmid #61463) as a backbone and replaced EGFP with PCR products that contained either mRuby3-2A-Cre-WPRE or mRuby3-2A-dCre-WPRE (the plasmids pAAV-Ef1a-fDIO-mRuby3-2A-Cre and pAAV-Ef1a-fDIO-mRuby3-2A-dCre respectively served as templates 28 ...
-
bioRxiv - Neuroscience 2024Quote: ... into a retrograde AAV helper vector (a gift from Alla Karpova & David Schaffer [Addgene plasmid # 81070; http://n2t.net/addgene:81070; RRID:Addgene_81070]) (Tervo et al. ...
-
bioRxiv - Neuroscience 2024Quote: AAV5-EF1α::DIO-hChR2(H134R)-EYFP (Addgene, 20298-AAV5) or AAV9-synP::DIO-EGFP (Addgene 100043-AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: Circular RNA overexpression utilised the Wilusz lab’s pcDNA3.1(+) ZKSCAN1 MCS Exon Vector (Plasmid #69901, Addgene), with the sense sequence of the RERE exons 5-12 (ENSRNOT00000024443.4 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CAG-tdTomato (codon diversified) was as gift from Edward Boyden (Addgene Plasmid #59462; http://n2t.net/addgene:59462; RRID:Addgene_59462). On DIV10 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CAG-tdTomato (codon diversified) was as gift from Edward Boyden (Addgene Plasmid #59462 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-Ef1a-DIO-EYFP (Addgene, #27056, 1.6 × 1013 vg/mL), AAV5-hSyn-Flex-GCaMP6s-WPRE (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV5-EF1a-DIO-eYFP (Addgene #27056; 1.3 x 1013 virus molecules/ml) in the MPO of NtsVGAT-/- to express ChR2 or eYFP ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-Ef1a-fDIO-GCamp6s (Addgene, #105714, 2.1 × 1013 vg/mL), AAV5&DJ-EF1a-fDIO-hChR2(H134R)-EYFP-WPRE (UNC Vector Core ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-Ef1a-fDIO-mCherry (Addgene, #114471, 2.3 × 1013 vg/mL), AAV8-Ef1a-fDIO-GCamp6s (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-hSyn-Flex-GCaMP6s-WPRE (Addgene, #100845, 2.9 × 1013 vg/mL), AAV5-EF1a-DIO-hChR2(H134R)-EYFP (UNC Vector Core ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2.1 viruses [camk2a_mCherry (titer 7.5 × 107 pc/μl, from Karl Deisseroth’s Lab, Addgene plasmid #114469); hSyn_hM4D(Gi)_mCherry (4.59 × 109 pc/ul ...
-
bioRxiv - Neuroscience 2024Quote: ... and pMD2.G (a gift of Didier Trono, Addgene 12259). 16 h post transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... trans-plasmid providing viral capsid PHP.(e)B (a generous gift from Viviana Gradinaru (Addgene plasmid #103005) and cis plasmid providing hCMV/HBA_wtRIBEYE-EGFP or tdTomato ...
-
bioRxiv - Neuroscience 2024Quote: ... constructs to make lentivirus (pMD2.G and psPAX2) were gifts of Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... were gifts of Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259; Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260). ALFA and HA tagged LRRTM2 KDR variants for transient expression in HEK cells were generated by replacing the GFP tag in KDR GFP-LRRTM2 previously described8 using NEB HIFI Gibson cloning ...
-
bioRxiv - Neuroscience 2024Quote: ... we used a non-conditional tracing approach by injecting 100 nL of AAV9-CAG-hChR2-mCherry (Addgene, Catalog#100054-AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV5-hSyn-Con/Fon-eYFP (Addgene 55650) and rAAV2-EF1a-DIO-Flpo (Addgene 87306).
-
bioRxiv - Neuroscience 2024Quote: ... or AAV5-gfaABC1D::iβARK-p2A-mCherry (Addgene #117691 ...
-
bioRxiv - Neuroscience 2024Quote: ... were used in this study: AAV1-syn-FLEX-jGCaMP7s-WPRE (Addgene, no ...
-
bioRxiv - Neuroscience 2024Quote: ... 2015) (gift from Drs. Casper Hoogenraad & Thomas Schwarz (Addgene plasmid # 176402; http://n2t.net/addgene:176402; RRID:Addgene_176402)) ...
-
bioRxiv - Neuroscience 2024Quote: ... and serotype PHP.S plasmid (a gift from Dr. Viviana Gradinaru, Addgene plasmids #103006) with PEI Max (Polysciences ...
-
bioRxiv - Neuroscience 2024Quote: ... regions of Trim46 were amplified with PCR from full length mouse Trim46L obtained from the GFP-Trim46 plasmid previously described in (van Beuningen et al., 2015) (gift from Drs. Casper Hoogenraad & Thomas Schwarz (Addgene plasmid # 176402 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were bilaterally injected to express PDE4A isoforms or GFP (Addgene #50469) in the hippocampal excitatory neurons using the CaMKII promoter ...
-
bioRxiv - Neuroscience 2024Quote: Eight-week old male C57BL/6J mice were injected with AAV9-syn-jGCaMP8f-WPRE virus (Addgene #162376-AAV9)(jGCaMP8f ...
-
bioRxiv - Neuroscience 2024Quote: ... constructs to make lentivirus (pMD2.G and psPAX2) were gifts of Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259; Addgene plasmid # 12260 ...
-
bioRxiv - Neuroscience 2024Quote: ... HA-spCas9 was a gift from Harold MacGillavry (Addgene plasmid # 131506; http://n2t.net/addgene:131506; RRID:Addgene_131506), constructs to make lentivirus (pMD2.G and psPAX2 ...
-
bioRxiv - Neuroscience 2024Quote: ... replacing the mCherry-KASH in Addgene #139652 (a gift from Harold MacGillavry; http://n2t.net/addgene:139652; RRID:Addgene_139652) with the mTagBFP2 gene and replacing the hSyn promoter with the CAG promoter for improved expression levels ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSyn-EGFP (Addgene, 50465) was injected into the sensorimotor cortex at 14 dpi ...
-
bioRxiv - Physiology 2024Quote: ... and co-transfected with pMD2.G and psPAX2 (Addgene, plasmid # 12259 and 12260) into HEK293T cells to produce virus ...
-
bioRxiv - Physiology 2024Quote: ... a unilateral 250Lnl injection of AAV1-syn-FLEX-jGCaMP7s-WPRE (titer: 1L×L1012Lvg/ml, Addgene #104487-AAV1) was used to express GCAMP7s into Sup5Phox2b.
-
bioRxiv - Neuroscience 2024Quote: ... the USP14 entry clone from the human ORFeome collaboration library was used to perform mutagenesis and the constructs obtained were transferred into the 2Flag-pDEST-N (118371, Addgene, USA) vector using standard reaction protocol ...
-
bioRxiv - Neuroscience 2024Quote: USP14_Reverse: 5’ AAACCCAATGGTATTCAAGGCTCACC 3’ were cloned into pSpCas9(BB)-2A-Puro vector (PX459, 62988, Addgene, USA) using FastDigest BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.Dlx.DIO.TVA was constructed by inserting the hDlx promoter fragment from pAAV-VTKD2 (Addgene #170847) into the backbone pAAV-EF1a-flex-TVA (Addgene #69618) ...
-
bioRxiv - Neuroscience 2024Quote: pAAV.Dlx.DIO.jGcamp8m plasmid was constructed by first flipping the MCS with BcuI with the backbone pAAV-VTKD2 (Addgene #170847)65 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used 2 male adult PV-cre mice injected with AAV-EF1a-DIO-tdTomato (University of North Carolina Vector Core, Chapel Hill, NC USA) and AAV-Syn-GCaMP7f (Addgene, Watertown, MA USA) and 2 male adult mice expressing Ca2+ indicator jRGECO1a in cells under the Thy1 promoter (Thy1-jRGECO1a ...
-
bioRxiv - Neuroscience 2024Quote: ... (Addgene # 46296 pCAG_GPHN.FingR-eGFP-CCR5TC), was a gift from D ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV-hSyn Coff/Fon hChR2(H134R)-EYFP (Addgene plasmid # 55648; http://n2t.net/addgene:55648; RRID:Addgene_55648) were gifts from Karl Deisseroth15 ...