Labshake search
Citations for Addgene :
3501 - 3550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... with targeted LentiCrispr V2 plasmid (Addgene Plasmid #98290), pSPAX (Addgene #12260) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25μg of psPax2 (Addgene #12260) and 10μg of pMD2.G (Addgene #12259 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10μg of pMD2.G (Addgene #12259) were added to 3ml of Opti-MEM (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... an eGFP open reading frame was transferred from pDONR221- eGFP (Addgene #25899)37 into pInducer20 (Addgene #44012)38 using the Gateway LR Clonase II Enzyme Mix (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... p404-BrdU-Inc (Addgene plasmid # 71790; http://n2t.net/addgene:71790; RRID:Addgene_71790) and p306-BrdU-Inc (Addgene plasmid # 71792 ...
-
bioRxiv - Genomics 2024Quote: ... pBL-TRP1-hsvTKCO-hENT1CO and pBL-AUR1C-hsvTKCO-hENT1CO plasmids are derivatives of p403-BrdU-Inc (Addgene plasmid # 71789; http://n2t.net/addgene:71789; RRID:Addgene_71789), p404-BrdU-Inc (Addgene plasmid # 71790 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... rosetta expression plasmid NK802 (Addgene; #166056)[28] replacing the mCherry sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse wild-type Pcyt2 cDNA (Horizon Discovery, MMM1013-202763346) was cloned into N174-MCS (Addgene, 81061) backbone digested with EcoRI and BamHI (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: Lentivirus was generated by co-transfection of viral vectors expressing sgRNA or cDNA of interest with packaging plasmids psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: sgRNA sequences targeting Atg7 (CACCGTCTCCTACTCCAATCCCGTG), Pcyt2, (CACCGCCATGATCCGGAACGGGCA) or a non-genic region on mouse chromosome 8 (Chr8, ACATTTCTTTCCCCACTGG) were cloned into lentiCRISPRv2 (Addgene, 52961). sgRNA sequences targeting Trp53 (GAAGTCACAGCACATGACGG ...
-
bioRxiv - Plant Biology 2024Quote: ... DsRed was amplified from pAG423GAL-ccdB-DsRed (Addgene plasmid repository, plasmid #14365) using primers 5’-GGAGGAGGAGGATCGATGGACAACACCGAGGACGT-3’ and 5’-GGCCCTCTAGATCAACTACTGGGAGCCGGAGTGG-3’ ...
-
bioRxiv - Plant Biology 2024Quote: ... and those from the MoClo Toolkit (Addgene #1000000044) as outlined by Engler et al ...
-
bioRxiv - Plant Biology 2024Quote: ... The plasmids used included the pICSL01009:AtU6p (Addgene under #46968), and those from the MoClo Toolkit (Addgene #1000000044 ...
-
bioRxiv - Cell Biology 2024Quote: ... and cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 vector (Addgene # 62988). HeLa cells were transfected with a pool of the three plasmids using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... three target sequences were selected from the human CRISPR knockout pooled library (Brunello, Addgene #73178) and cloned into pSpCas9(BB)-2A-Puro (PX459 ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCAG-GFP (Addgene #11150), pCAG-PiggyBac transposase or PB-pCAG-H2B-GFP (final concentration ...
-
bioRxiv - Bioengineering 2024Quote: ... HEK 293T cells were cotransfected with a three-plasmid combination: pMD2.G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmids YAP1 (S6A)-V5 in pLX304 and pLX304 were obtained from Addgene as gifts from William Hahn (plasmid 42562 ...
-
bioRxiv - Bioengineering 2024Quote: ... pLX304 (Addgene plasmid # 25890; http://n2t.net/addgene:25890; RRID:Addgene_25890); YAP1 (S6A ...
-
bioRxiv - Biochemistry 2024Quote: ... isoform 1) was amplified from K562 cDNA and inserted into insect cell expression vector 438-B (Addgene plasmid: 55219) (N-terminal 6x His (His6 ...
-
bioRxiv - Biochemistry 2024Quote: ... coli expression vector 1B (N-terminal 6x His (His6) tag followed by Tobacco etch virus (TEV) protease cleavage site) (Addgene plasmid: 29653).
-
bioRxiv - Biochemistry 2024Quote: ... tag followed by Tobacco etch virus (TEV) protease cleavage site) and 438-C (Addgene plasmid: 55220) (N-terminal His6-Maltose binding protein (MBP ...
-
bioRxiv - Bioengineering 2024Quote: ... Plasmids to express GFP-FKBP or FKBP-AP2B1-GFP (Addgene #100726) were available from previous work (Wood et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... pBAD24-sfGFPx1 was a gift from Sankar Adhya & Francisco Malagon (Addgene plasmid # 51558 ...
-
bioRxiv - Bioengineering 2024Quote: ... mCherry-FRB was amplified from CD8-mCherry-FRB (Addgene #100738) and inserted into Alpha5 integrin-GFP (Addgene #15238 ...
-
bioRxiv - Neuroscience 2024Quote: ... a total of 0.6 µL of AAV5-Syn-GCaMP6s virus (1.8 × 1013 genome copies per mL, Addgene) was slowly injected by Nanoject III Nanoliter Injector into layer 2/3 motor cortex (1.5 mm anterior from bregma ...
-
bioRxiv - Neuroscience 2024Quote: The pAAV-hSyn-DIO-hM4D(Gi)-mCherry (DREADD virus) (4*10^12 gc/ml, Addgene, United States, addgene.org) or pAAV-hSyn-DIO-mCherry (4.2*10^12 gc/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... mice were injected in LHA with AAV5-hSyn-DIO-eGFP (1*10^12vc/ml; Addgene) and co-injected with rAAV5-ORXpr1-3TdTomato (1*10^12 gc/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... We packaged pAAV-hSyn-eNpHR 3.0-EYFP (a gift from Karl Deisseroth [Addgene plasmid #26972; http://n2t.net/addgene:26972; RRID:Addgene_26972]) and pAAV-hSyn-EGFP (a gift from Bryan Roth [Addgene plasmid # 50465 ...
-
bioRxiv - Neuroscience 2024Quote: ... The sequences of jGCaMP7f gene and jGCaMP7s were amplified by PCR from pGP-AAV-syn-jGCaMP7f-WPRE and pGP-AAV-syn-jGCaMP7s-WPRE (a gift from Douglas Kim & GENIE Project, Addgene plasmid #104488 and #104487) and inserted into sites of GFP in pAAV/L7-6-GFP-WPRE (a gift from Hirokazu Hirai ...
-
bioRxiv - Neuroscience 2024Quote: ... Recombinant mouse myc-netrin-1 was cloned into pSBI-GN vector (Addgene, 60517) to prepare a stable HEK293 cell line expressing mouse netrin-1.
-
bioRxiv - Neuroscience 2024Quote: ... and into sites of GFP in pAAV-TRE-EGFP (a gift from Hyungbae Kwon, Addgene plasmid # 89875) (pAAV-TRE-jGCaMP7f and pAAV-TRe-jGCaMP7s) ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV-hSyn-EGFP (a gift from Bryan Roth [Addgene plasmid # 50465 ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV-hSyn-EGFP (a gift from Bryan Roth [Addgene plasmid # 50465; http://n2t.net/addgene:50465;RRID:Addgene_50465]) into a retrograde AAV helper vector (a gift from Alla Karpova & David Schaffer [Addgene plasmid # 81070 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1) and inserted into sites of hSyn promoter in AAV-U6-sgRNA-hSyn-mCherry (a gift from Alex Hewitt, Addgene plasmid # 87916) (AAV-hMAG-mcherry) ...
-
bioRxiv - Neuroscience 2024Quote: ... and inserted into sites of GFP in pAAV/L7-6-GFP-WPRE (a gift from Hirokazu Hirai, Addgene plasmid # 126462) (pAAV-L7-6-jGCaMP7f and pAAV-L7-6-jGCaMP7s ...
-
bioRxiv - Neuroscience 2024Quote: ... We used AAVretrograde-gCaMP7f (1.8×1013) (pGP-AAV-syn-jGCaMP7f-WPRE was a gift from Douglas Kim & GENIE Project [Addgene viral prep # 104488-AAVrg ...
-
bioRxiv - Neuroscience 2024Quote: ... We packaged pAAV-hSyn-eNpHR 3.0-EYFP (a gift from Karl Deisseroth [Addgene plasmid #26972 ...
-
bioRxiv - Neuroscience 2024Quote: ... The UNC5C-pHmScarlet was created using pCDNA3-UNC5CHA (Guofa Liu, University of Toledo) and pH-sensitive mScarlet0 (Addgene, 166891), positioning mScarlet0 after the Ig2 domain within the extracellular region of UNC5C ...
-
bioRxiv - Neuroscience 2024Quote: ... (pAAV.Syn.NES-jRGECO1a.WPRE.SV40 was a gift from Douglas Kim & GENIE Project (Addgene viral prep # 100854-AAVrg; http://n2t.net/addgene:100854; RRID:Addgene_100854) (Dana et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... we amplified the DTA coding sequence from the pAAV-mCherry-flex-dtA (a gift from Naoshige Uchida, Addgene plasmid # 58536) using primer pairs (Table ...
-
bioRxiv - Neuroscience 2024Quote: ... into a retrograde AAV helper vector (a gift from Alla Karpova & David Schaffer [Addgene plasmid # 81070 ...
-
bioRxiv - Neuroscience 2024Quote: ... (pGP-AAV-syn-jGCaMP7f-WPRE was a gift from Douglas Kim & GENIE Project [Addgene viral prep # 104488-AAVrg; http://n2t.net/addgene:104488; RRID:Addgene_104488) and AAVretrograde-jRGECO1a (7×1012 ...
-
bioRxiv - Neuroscience 2024Quote: ... and AAVretrograde-jRGECO1a (7×1012) (pAAV.Syn.NES-jRGECO1a.WPRE.SV40 was a gift from Douglas Kim & GENIE Project (Addgene viral prep # 100854-AAVrg ...
-
bioRxiv - Neuroscience 2024Quote: ... we amplified the sequences of Kir2.1-T2A-GFP from the pAAV hSyn FLEx-loxp Kir2.1-2A-GFP (a gift from Kevin Beier & Robert Malenka, Addgene plasmid # 161574), and cloned it into sites of GFP in pAAV-TRE-EGFP ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CAG-GFP was a gift from Edward Boyden (Addgene viral prep # 37825-PHPeB; http://n2t.net/addgene:37825; RRID:Addgene_37825). The viral vectors were purified by iodixanol gradient ultracentrigation and titered by ddPCR in the manufacturer’s facility ...
-
bioRxiv - Neuroscience 2024Quote: The AAV.PHP.eB::CAG-GFP [21] (2.6 X 1013GC/ml) was produced by Addgene, pAAV-CAG-GFP was a gift from Edward Boyden (Addgene viral prep # 37825-PHPeB ...
-
bioRxiv - Neuroscience 2024Quote: ... and rAAV2-EF1a-DIO-Flpo (Addgene 87306).
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290) (Gohl et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... USA (pAAV5-CaMKIIa-hM4D(Gi)-mCherry and pAAV5-CaMKIIa-hM3D(Gq)-mCherry were gifted from Bryan Roth (Addgene viral prep # 50477and # 50476; pAAV-CaMKIIa-mCherry was a gift from Karl Deisseroth (Addgene plasmid # 114469). Viral constructs were used as is or diluted in saline before use ...