Labshake search
Citations for Addgene :
3301 - 3350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: The FoxO1-mRuby2 construct was cloned into the pLenti-puro lentiviral backbone using Gibson cloning and the pLenti-FoxO1-Clover70 and ERKKTR-mRuby constructs23 (Addgene plasmids nb 67759 & 90231 ...
-
bioRxiv - Biophysics 2024Quote: ... studies with an anti-YFP-nanobody (Addgene plasmid #61838) (Hartano et al ...
-
bioRxiv - Biophysics 2024Quote: ... The HaloTag-beta2-adrenergic receptor was a gift from Catherine Berlot (Addgene plasmid # 66994).
-
bioRxiv - Biophysics 2024Quote: Exo70 was amplified from pEGFP-C3-Exo70 (Addgene plasmid #53761) using the primers 5’-CGGAATTCTG ATGATTCCCC CACAGGAGG-3’ and 5’-GCGTCGACAC GGCAGAGGTG TCGAAAAGGC-3’ and was inserted into the pSEMS-HaloTag-vector .
-
bioRxiv - Genomics 2024Quote: ATF4 reporter Viral particles were made from pSMALB-ATF4.5 vector (a gift from John Dick & Peter van Galen; Addgene plasmid # 155032 ...
-
bioRxiv - Microbiology 2024Quote: GECs were transfected with 1 µg of pFLAG-CMV2-Hsp27-S78D/S82D (Addgene plasmid # 85187 [69]), a constitutively activated HSp27 construct ...
-
ZNF143 binds DNA and stimulates transcription initiation to activate and repress direct target genesbioRxiv - Genomics 2024Quote: ... We generated a linear homology-directed repair donor by amplifying the pCRIS-PITChv2-dTAG-Puro plasmid (Addgene #91796) with the primers in Table 1 (Nabet et al ...
-
bioRxiv - Genomics 2024Quote: We modified pLentiRNACRISPR_007 (Addgene 138149 ...
-
bioRxiv - Genomics 2024Quote: ... VSV G pseudotyped lentivirus was prepared at the OHSU virology core using pHR-hSyn-eGFP plasmid (Addgene plasmid #114215) with a titer of 1.0x109 TU/mL ...
-
bioRxiv - Genomics 2024Quote: ... and pMD2.G (psPAX2 and pMD2.G were a gift from Didier Trono, Addgene plasmid # 12260 ; http://n2t.net/addgene:12260 ; RRID:Addgene_12260) were obtained from Addgene ...
-
bioRxiv - Immunology 2024Quote: ... and 3.5 ug of PmD2.G (Addgene, Cat #12259) using Lipofectamine 2000 transfection reagent (Invitrogen cat # 11668019) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Pegl-20::mCherry::PH was constructed by Gibson assembly using Pwrt-2::gfp::PH (Wildwater et al., 2011) and pCFJ104 (Frøkjaer-Jensen et al., 2008) (a gift from Erik Jorgensen (Addgene plasmid # 19328 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2008) (a gift from Erik Jorgensen (Addgene plasmid # 19328; http://n2t.net/addgene:19328; RRID:Addgene_19328)) as PCR templates to amplify PH domain and mCherry ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNAs were amplified from the corresponding pJet1.2 vectors and pPD95.81 (a gift from Andrew Fire (Addgene plasmid # 1497 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were PCR-amplified from N2 genomic DNA with primers harbouring overhangs for Gibson assembly with the pDD282 vector (Dickinson et al., 2013) (a gift from Bob Goldstein (Addgene plasmid # 66823 ...
-
bioRxiv - Developmental Biology 2024Quote: ... were PCR-amplified from N2 genomic DNA with primers harbouring overhangs for Gibson assembly with the pDD282 vector (Dickinson et al., 2013) (a gift from Bob Goldstein (Addgene plasmid # 66823; http://n2t.net/addgene:66823; RRID:Addgene_66823)) and assembled with pDD282 digested with ClaI and SpeI ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNAs were amplified from the corresponding pJet1.2 vectors and pPD95.81 (a gift from Andrew Fire (Addgene plasmid # 1497; http://n2t.net/addgene:1497; RRID:Addgene_1497)) was a source of backbone and GFP sequences ...
-
bioRxiv - Neuroscience 2024Quote: ... psPAX2 (#12260 Addgene), and the empty (EV) ...
-
bioRxiv - Neuroscience 2024Quote: ... a gift from David Baltimore (Addgene #22227). Knockdown experiments were performed with the following siRNAs ...
-
bioRxiv - Neuroscience 2024Quote: ... (AAV9)hSyn.DIO.hM3D.mCherry (Addgene 44361); INTRSCT construct (pHP.eb)hSyn.Cre-on/Flp-on.YFP (Addgene 55650)62.
-
bioRxiv - Molecular Biology 2024Quote: ... and pMSP2N2 (Addgene plasmid #29520 ...
-
bioRxiv - Neuroscience 2024Quote: ... and pCAG-T7pol (Addgene #59926) for the rescue step 150 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 100 ng of pBABE puro plasmid (Addgene plasmid #1764 ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... and DPP4 (Addgene #158452) was used ...
-
bioRxiv - Genomics 2024Quote: ... pRDA_052 (Addgene 136474)45 was used for AsCas12a and an FUGW plasmid was used for LbCas12a ...
-
LRBA balances antigen presentation and T-cell responses via autophagy by binding to PIK3R4 and FYCO1bioRxiv - Immunology 2024Quote: ... and pEGFO-C1-hUVRAG (Addgene # 24296) were provided by Jonathan Backer (19) ...
-
LRBA balances antigen presentation and T-cell responses via autophagy by binding to PIK3R4 and FYCO1bioRxiv - Immunology 2024Quote: ... pEGFP-Atg14L (Addgene #21635) and pEGFO-C1-hUVRAG (Addgene # 24296 ...
-
bioRxiv - Molecular Biology 2024Quote: ... then inserted into pCRY2olig-mCherry (Addgene) at the NheI and XhoI sites (pGFP-CRY-R).
-
bioRxiv - Molecular Biology 2024Quote: ... then a fragment of CRY2olig region that was digested from pCRY2olig-mCherry (#60032; Addgene, Watertown, MA, USA) was inserted at the NheI and SmaI sites (pCRY-C220- ...
-
bioRxiv - Neuroscience 2024Quote: ... The cannula implant allowed the injection of viral vector (0.5 µl AAV1-Syn-GCaMP6m, Addgene, ID 100841) into the hippocampal CA1 region (coordinate ...
-
bioRxiv - Neuroscience 2024Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Synthetic Biology 2024Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ...
-
bioRxiv - Synthetic Biology 2024Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ; http://n2t.net/addgene:140957 ; RRID:Addgene_140957)
-
bioRxiv - Cell Biology 2024Quote: ... with lentiviral backbone constructs and packaging vectors (psPAX2 and pMD2.G; Addgene #12260 and #12259) using TransIT-LT1 (Mirus Bio #MR 2306) ...
-
bioRxiv - Cell Biology 2024Quote: ... and DAM-lamin B1 (AddGene, 119764) using Lipofectamine 3000 reagent (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... The Brunello CRISPR library (Addgene #73178 (73)) was used to generate our genome-wide collection of mutant RKO cells ...
-
bioRxiv - Cell Biology 2024Quote: ... The clonal reporter line was transduced with Cas9 (lentiCas9- Blast; Addgene#52962) and a second round of clonal derivation was performed to generate multiple clonal cell lines that were analyzed for optimal Cas9 expression and WNT3A-induced EGFP reporter fluorescence ...
-
bioRxiv - Cell Biology 2024Quote: ... 18 million 293FT cells were seeded in T225 flasks (40 flasks in total) and transfected the following day with 3.4 μg pMD2.G (Addgene #12259), 6.8 μg psPAX2 (Addgene#12260) ...
-
bioRxiv - Cell Biology 2024Quote: ... 6.8 μg psPAX2 (Addgene#12260), and 13.6 μg lentiviral target (CRISPR ...
-
bioRxiv - Neuroscience 2024Quote: pAAV-CMV-Cre-GFP was obtained from Addgene Cat No ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2-5 were obtained from Addgene. pHelper plasmid was a gift from Matthew Banghart at the University of California ...
-
bioRxiv - Cancer Biology 2024Quote: ... These were ligated into LentiCRISPRv2-mCherry (Addgene #99154), digested with BsmBI (NEB #R0580) ...
-
bioRxiv - Cell Biology 2024Quote: ... (Addgene nos ...
-
bioRxiv - Cell Biology 2024Quote: ... into the pDONOR MCS Rosa26 plasmid (Addgene #37200) containing Rosa26 homology harms ...
-
bioRxiv - Cancer Biology 2024Quote: ... The N-Terminal pFLAG 3 vector (Addgene) was employed for cloning the DCLK1 DCX DNA by restriction digest ...
-
bioRxiv - Genetics 2024Quote: ... pSpCas9n(BB)-2A-GFP (PX461) was a kind gift from Feng Zhang (Addgene plasmid #48140 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-EF1a-double floxed-hChR2 (H134R)-mCherry-WPRE-HGHpA (Addgene plasmid #20297). Flp recombinase dependent AAV vectors were constructed in house ...
-
bioRxiv - Cell Biology 2024Quote: ... a generous gift from Franck Polleux (Kwon et al., 2016) (Addgene plasmid # 105009; http://n2t.net/addgene:105009; RRID:Addgene_105009), preincubated with XTremeGENE HP Transfection Reagent (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with 900 ng psPAX2 (psPAX2 was a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID:Addgene_12260)) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1μg of pDEST-CMV mCherry-GFP-LC3B WT (Addgene plasmid # 123230; http://n2t.net/addgene:123230; RRID:Addgene_123230, Agrotis & Ketteler)30 per well using X-tremeGene HP (Roche ...