Labshake search
Citations for Addgene :
3101 - 3150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced via transfection of pooled library plasmids with appropriate packaging plasmids (psPAX2-Addgene 12260; pMD2.G-Addgene 12259) using linear polyethylenimine (PEI ...
-
ZNF143 binds DNA and stimulates transcription initiation to activate and repress direct target genesbioRxiv - Genomics 2024Quote: ... We cleaved the hSpCas9 plasmid PX458 (Addgene #48138) with the enzyme BbsI ...
-
bioRxiv - Genomics 2024Quote: ... with a GFP-P2A-Puro cassette from pLentiRNAGuide_003 (Addgene 192505) using NheI and ApaI restriction sites ...
-
bioRxiv - Genomics 2024Quote: ... pCW57.1 (pCW57.1 was a gift from David Root, Addgene plasmid # 41393 ; http://n2t.net/addgene:41393 ; RRID:Addgene_41393), psPAX2 ...
-
bioRxiv - Genomics 2024Quote: ... pCW57.1 (pCW57.1 was a gift from David Root, Addgene plasmid # 41393 ...
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced via transfection of pooled library plasmids with appropriate packaging plasmids (psPAX2-Addgene 12260; pMD2.G-Addgene 12259) using linear polyethylenimine (PEI ...
-
bioRxiv - Genomics 2024Quote: ... and 0.55 μg pMD2.G (Addgene 12259). Two days post-transfection ...
-
bioRxiv - Microbiology 2024Quote: ... the LC3B in pBABE-puro mCherry-EGFP-LC3B (Addgene, Plasmid #22418) was replaced with the LC3C at EcoRI and SalI site to make pBABE-puro mCherry-EGFP-LC3C ...
-
bioRxiv - Microbiology 2024Quote: ... programmed frameshift sites of each nidovirus were placed between the coding sequence of EGFP and mCherry (parental Addgene plasmid # 8780362) by Gibson assembly such that EGFP would be produced in 0-frame and mCherry in –1-frame with the −1PRF sequence50,51 ...
-
bioRxiv - Genomics 2024Quote: MORF library without GFP and mCherry controls (Addgene #192821) was transformed into electrocompetent NEB Stable E ...
-
bioRxiv - Genomics 2024Quote: ... The DUX4-inducible plasmid pCW57.1-DUX4-CA was obtained from Addgene (#99281).
-
bioRxiv - Immunology 2024Quote: ... TRE CAR construct was generated from pHR_Gal4UAS_pGK_mCherry (Addgene #79124) by inserting a TRE promoter and removing GAL4 UAS promoter via EcoRI restriction digestion and cloning CD19 CAR construct into the multiple cloning site ...
-
bioRxiv - Immunology 2024Quote: iOnEmpty vector was built into the TLCV2 plasmid from Addgene (#87360) by amplifying and cloning its own tight TRE promoter into the backbone and removing the U6 Promoter-empty gRNA-Tight TRE Promoter-Cas9 cassette via KpnI-BamHI restriction digestion ...
-
bioRxiv - Genomics 2024Quote: ... a variant of which containing a ribosomal binding site and mRFP in place of a gene fragment has been deposited to Addgene (Addgene #209325). A slight modification to this plasmid was made to include SapI type II restriction sites ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently the iOffCAR constructs were built on iOnEmpty by swapping the rtTA with tTA from the pHR_PGK_antiCD19_synNotch_TetRVP64 vector from Addgene (#79126) via XbaI-XhoI sites ...
-
bioRxiv - Immunology 2024Quote: ... Anti-CD19 scFv amino acid sequence was obtained from Addgene plasmid #79125 ...
-
bioRxiv - Genomics 2024Quote: ... and pGal/Pol (Addgene, Watertown, MA). The transfected cells were incubated for 16 h ...
-
bioRxiv - Genomics 2024Quote: ... expressing a control shRNA or plasmid pAPM-D4 miR30-TRIM28 ts3 (Addgene #115864) (27 ...
-
bioRxiv - Microbiology 2024Quote: The assembled tRNA genomic sequence was then inserted into the EcoRI/PstI-digested pBSTNAV vector (AddGene, USA). The final construct contained the tRNA under the control of the constitutive lpp promoter ...
-
bioRxiv - Immunology 2024Quote: ... 10μg envelope plasmid pMD2.G (A gift from Didier Trono (Addgene #12259)) and 30μg packaging plasmid psPAX2 (A gift from Didier Trono (Addgene #12260) ...
-
bioRxiv - Genomics 2024Quote: ... lacZ reporter gene and H11 locus homology arms (Addgene, 139098) using NEBuilder HiFi DNA Assembly Mix (NEB ...
-
bioRxiv - Immunology 2024Quote: ... annealed and individually cloned into vector plasmids lentiGuide-Puro (Addgene #52963) or lentiGuide-mCherry (Plasmid #170510) ...
-
bioRxiv - Immunology 2024Quote: ... and 30μg packaging plasmid psPAX2 (A gift from Didier Trono (Addgene #12260)) in opti-MEM media (ThermoFisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid #12259); psPAX2 was a gift from Didier Trono (Addgene plasmid #12260) ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 was a gift from Didier Trono (Addgene plasmid #12260). Single-guide RNAs (sgRNAs ...
-
bioRxiv - Genomics 2024Quote: Plasmids hSTARR-seq_SCP1 vector (Addgene plasmid # 99292 ...
-
bioRxiv - Genetics 2024Quote: ... we adapted a 3xP3-DsRed marker (flanked by piggyBac termini) from the pScarlessHD plasmid (a gift from Kate O’Connor-Giles, Addgene plasmid # 64703) and introduced two ∼1kb homology arms flanking the two guide RNA target sites ...
-
bioRxiv - Genomics 2024Quote: ... and hSTARR-seq_ORI vector (Addgene plasmid # 99296 ...
-
bioRxiv - Cell Biology 2024Quote: ... These were amplified by two miR-E universal primers (fwd 5′-CTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGA CAGTGAGCG-3′) (rev 5′-ACAAGATAATTGCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGT AGGCA-3′) and cloned into the XhoI and EcoRI double digested LT3GEPIR lentiviral vector (Addgene #111177). HEK293T cells were transfected with these vectors to produce lentivirus which was then used to transduce lamin TKO mESCs ...
-
bioRxiv - Cell Biology 2024Quote: Lbr knockout was performed by lipofectamine transfection of the PX458 CRISPR/Cas9 plasmid (Addgene #48138) with one guide targeting exon 2 of Lbr (TCATAATAAAGGGAGCTCCC) ...
-
bioRxiv - Cancer Biology 2024Quote: ... PGC-1α cDNA from pcDNA4 myc PGC-1 alpha (Addgene #10974) was cloned into the FUBW backbone driven by a ubiquitin promoter ...
-
bioRxiv - Cancer Biology 2024Quote: ... 786-O cells were transfected with PX458 plasmid (#48138, Addgene) containing RB1 targeting single guide RNAs (sgRNAs) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Flag-pRb plasmid was obtained by cloning Flag-tagged pRb into the pLVX-M-puro vector (#125839) from Addgene. For overexpression studies ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLenti-ATF4-uORF-GFP reporter plasmid was generated by placing the ATF4 5’UTR from Addgene plasmid #21850 ...
-
bioRxiv - Cancer Biology 2024Quote: ... we first replaced Puromycin with a Blasticidin resistance marker in LT3GEPIR (Addgene plasmid # 111177), a gift from Johannes Zuber (11) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The latter targeting vectors were cloned by linearizing cTGME shPten (Addgene plasmid #135667) (14 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 16 ng pRL-SV40P (Addgene #27163) per well using lipofectamine 3000 (Thermo Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... psPAX2 (a gift from Didier Trono; Addgene_12260), and pMD2.G (a gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2024Quote: The pooled genome-wide CRISPR knockout library (Addgene, #1000000132) was kindly provided by Prof ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected for 6 hours with 80 ng 3xERRE-ERE-luciferase containing codon-modified firefly luciferase (Addgene #37852) and 16 ng pRL-SV40P (Addgene #27163 ...
-
bioRxiv - Cancer Biology 2024Quote: ... We then extracted the corresponding sgRNA sequences and annotations for these genes from the Human CRISPR Knockout Library H3 (contributed by Profs. X. Shirley Liu and Myles Brown, Addgene pooled library #133914). On average ...
-
bioRxiv - Cancer Biology 2024Quote: For RNF2 knock-out we used pLKO5.sgRNA.EFS.GFP (Addgene, 57822) vector targeting the following sequences ...
-
bioRxiv - Systems Biology 2024Quote: ... and the corresponding sgRNA sequence (GTGCGAGTAGAAAACGTTAA) was cloned into the pX459 plasmid (Addgene #62988) using BbsI Golden Gate cloning ...
-
bioRxiv - Systems Biology 2024Quote: ... Lentiviral constructs of either RGEDI2 or pHR-hSyn:EGFP (Addgene #114215)3 were added to the cell suspension at 5 MOI at the time of passage and removed after 48 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... and the homology arms and gBlock were inserted into the pUC18 plasmid (Addgene #50004) linearized with HindIII and BamHI.
-
bioRxiv - Systems Biology 2024Quote: ... Individual sgRNA was cloned into lentiviral vector pMK1334 expressing BFP (Addgene Cat# 127965). Lentiviruses carrying sgRNAs were produced in Lenti-X 293T cells (Takara Bio ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK293T cells were co-transfected with lenti-EF1a-dCas9-KRAB-Puro plasmid (a gift from Kristen Brennand; Addgene_99372) or pLV-dCas9-p300-P2A-PuroR plasmid (a gift from Charles Gersbach ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and pMD2.G (a gift from Didier Trono; Addgene_12259) using TransIT-Lenti Transfection Reagent (Mirus Bio ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... or pLV-dCas9-p300-P2A-PuroR plasmid (a gift from Charles Gersbach; Addgene_83889), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The gRNA expression empty vector lentiGuide-Puro was a gift from Feng Zhang (Addgene_52963). pCMV-FLAG LAP2 was a gift from Joan Massague (Addgene_15738) ...