Labshake search
Citations for Addgene :
1 - 50 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... shRNAs with sequences listed in Table S3 were cloned into tet-inducible vector Tet-pLKO-puro (Addgene #21915). To generate luciferase reporters ...
-
bioRxiv - Cell Biology 2024Quote: ... and Deaf1 shRNAs were cloned into pAAV-Ptet-RFP-shR-rtTA (Addgene, #35625). The Deaf1 and Deaf1-shRNA carrier AAV vectors were transfected with pAAV-R/C (AAV serotype 9 [AAV9] ...
-
bioRxiv - Cell Biology 2024Quote: ... and FOXO3-AAA (Addgene, #1788) were obtained from Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... Constitutively active FoxO1-ADA-GFP (Addgene, #35640) and FOXO3-AAA (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: Deaf1 cDNA was cloned into pAAV-CAG-GFP (Addgene, #37825), and Deaf1 shRNAs were cloned into pAAV-Ptet-RFP-shR-rtTA (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from Addgene. To knockout Deaf1 ...
-
bioRxiv - Cell Biology 2024Quote: ... into pLX313 backbone plasmid (Addgene, #118014). Constitutively active FoxO1-ADA-GFP (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 18 μg of psPAX2 gag/pol packaging plasmid (Addgene 12260), and 12 μg of pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Cell Biology 2024Quote: pGP-CMV-GCaMP6f was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 40755; http://n2t.net/addgene:40755; RRID:Addgene 40755). For the SNAP25-GCaMP6f tagged version ...
-
bioRxiv - Cell Biology 2024Quote: pGP-CMV-GCaMP6f was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 40755 ...
-
bioRxiv - Cell Biology 2024Quote: ... The AAVS1-iSAM are available on Addgene (Addgene #211495) and the gRNA 2.1 plasmids (Addgene #211496 ...
-
bioRxiv - Cell Biology 2024Quote: Cells were seeded in 10 mm plates at 60% of confluence in complete medium and then co-transfected with MPAct mCherry and YFP-CaaX vectors (selected plasmid constructs, corresponding sequence information is available on Addgene) 35 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the gRNA 2.1 plasmids (Addgene #211496) (both currently on hold) ...
-
bioRxiv - Cell Biology 2024Quote: mmu-mito-ncR-LDL805 (GAATTGATCAGGACATAGGGTTTGATAGTTAATATTATATGTCTTTCAAGTTCTTAG TGTTTTTGGGGTTTGGC) and hsa-mito-ncR-LDL805 (GAACGTGTGGGCTATTTAGGCTTTATGGCCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTTAGCTACCC) sequences were cloned into pZW1-Sno Vector (Addgene plasmid #73174 ...
-
bioRxiv - Cell Biology 2024Quote: The Capture sequence 2 was added to the gRNA_Puro_Backbone (Addgene #73797) by PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... was derived from the UniSAM plasmid that we previously generated (Addgene #99866) by PCR with the following primer sets
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting pU6-chiRNA cassette was amplified by PCR and inserted into the pnos-Cas9-nos plasmid (Addgene #62208) at the NheI restriction site ...
-
bioRxiv - Developmental Biology 2024Quote: ... Oligonucleotides with these overhangs and a region complementary to the sequence of GFPnovo2 (in plasmid pSM Addgene) or mKate (in plasmid pCFJ350 Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products or Plasmids were micro-injected into CB4088 [him-5(e1490)] hermaphrodites with myo-2::mCherry from plasmid pCFJ90 (Addgene) as co-injection marker ...
-
bioRxiv - Developmental Biology 2024Quote: ... or mKate (in plasmid pCFJ350 Addgene) were used to PCR amplify the homology repair template (Takara PrimeStar Max) ...
-
bioRxiv - Developmental Biology 2024Quote: ... a region extending from the gene upstream of the transcription start site of a candidate gene plus the first exon and intron of that gene was fused to the sequence of GFP in plasmid pPD95.75 (Fire Vector kit, Addgene) which also contains the unc-54 3’UTR ...
-
bioRxiv - Developmental Biology 2024Quote: ... worms were grown on bacteria expressing double stranded RNA for him-8/klp-16 using the pLT 651 plasmid (Addgene plasmid # 59998, Timmons et al., 2014).
-
bioRxiv - Developmental Biology 2024Quote: ... pX330-SpCas9-HF1 was a gift from Yuichiro Miyaoka (Addgene plasmid#108301;http://n2t.net/addgene:108301; RRID:Addgene_108301) Sequences were confirmed via Sanger sequencing ...
-
bioRxiv - Cell Biology 2024Quote: ... The target sequence of CCTGTTTCTTGTTCGAGAGCTTC on exon28 (NM_020314.7) was inserted into the px458 plasmid (Addgene plasmid no. 48138) and transfected to cells using PEI ...
-
bioRxiv - Cell Biology 2024Quote: ... HA::hOCRL cDNA was amplified from the pcDNA3-HA::hOCRL (Addgene-Plasmid# 22207). Not1 and Xba1 restriction sites were used to amplify the amplicon of 2730 bp and ligated into pUAST-attB vector (Drosophila Genomic Resource Center-Stock#1419) ...
-
bioRxiv - Cell Biology 2024Quote: ... pMD2.G (# 12259, Addgene, USA), and indicated individual sgRNA constructs at a ratio of 2:1:3 ...
-
bioRxiv - Cell Biology 2024Quote: Individual single-guide RNAs (sgRNAs) (sgBTN3A2 #1: TGTTCTCTCCCTTGGCGTTGCTCCACTGTA; sgBTN3A2 #3: ATCATGAGAGGCGGCTCCGGGGAGGGTGTATC) targeting the candidate gene were cloned into linearized lentiCRISPRv2 (#52961, Addgene, USA). Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260, Addgene, USA), pMD2.G (# 12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... A plasmid transiently expressing Sencyt was previously described as L_NLS 41kDa (Andreu et al., 2022) and is available in addgene (Addgene plasmid # 201342 ; http://n2t.net/addgene:201342 ; RRID: Addgene_201342). For the creation of stable cell lines expressing Sencyt ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1-mCherry was a gift from David Bartel (Addgene plasmid # 128744; http://n2t.net/addgene:128744;RRID:Addgene_128744).
-
bioRxiv - Cell Biology 2024Quote: ... A plasmid transiently expressing Sencyt was previously described as L_NLS 41kDa (Andreu et al., 2022) and is available in addgene (Addgene plasmid # 201342 ...
-
bioRxiv - Cell Biology 2024Quote: ... The pX330 was co-transfected with pCAG-EGFP into E14tg2a with MERVL::TurboGFP (Addgene plasmid #69072 ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1-mCherry was a gift from David Bartel (Addgene plasmid # 128744 ...
-
bioRxiv - Cell Biology 2024Quote: ... Dux and Pramel7 were generated in pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 ...
-
bioRxiv - Cell Biology 2024Quote: ... and infected with PIP-FUCCI (Addgene, #118621) or H2B-CFP lentivirus at ≤ P (passage ...
-
bioRxiv - Cell Biology 2024Quote: ... Pink Flamindo was a gift from Tetsuya Kitaguchi (Addgene plasmid #102356) (17) ...
-
bioRxiv - Cell Biology 2024Quote: ... pSpCas9(BB)-2A-Halo was generated by replacing GFP with HaloTag in pSpCas9(BB)-2A-GFP (PX458) (Addgene #488138). SUM159 cells were transfected with 1000 ng of the plasmid containing the sgRNA targeting sequence using Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 12 μg of pMD2.G VSV-G envelope plasmid (Addgene 12259) with 135 μL of Lipofectamine in 6.75 mL of OptiMEM media (Thermo Fisher 51985091) ...
-
bioRxiv - Cell Biology 2024Quote: The lentiviral vector named lenti-CRISPRv2-mCherry was acquired from Addgene (99154). This vector contained several DNA fragments including gRNA scaffold ...
-
bioRxiv - Cell Biology 2024Quote: ... psPAX2 (12260) and pMD2.G (12259) was also from Addgene, which were co-transfection with lentiviral vector to generate lentivirus.
-
bioRxiv - Cell Biology 2024Quote: ... SRSF2 was obtained from Addgene. All coding sequences were verified by DNA sequencing.
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg pMD2.G (AddGene G12259) and 3 μg psPAX2 (AddGene 12260 ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR-based knockout cell lines were generated using the lentiCRISPRv2 vector obtained from Addgene, which expresses a single guide RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... YFP-RPB1-WT (52xCTD) was obtained from Addgene, YFP-RPB1-26xCTD and T4E/S7E mutants were generated by PCR-based cloning performed by a kit from ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... were generated by simultaneously targeting RNF43 (gRNA: ATTGCACAGGTACAGCGGGT) and ZNRF3 (gRNA: GCCAAGCGAGCAGTACAGCG) with gRNAs cloned in a pSpCas9(BB)-2A-Puro vector (Addgene # 48139). Monoclonal cell lines that were homozygous knockout for both genes were confirmed by genotyping and functional analysis in a β-catenin-mediated reporter assay (Fig ...
-
bioRxiv - Cell Biology 2024Quote: The GCaMP5G plasmid was procured from Addgene (Cat# 31788). Lck was fused to GCaMP5G as described in Shigetomi et al ...
-
bioRxiv - Cell Biology 2024Quote: ... the HA-KDM4A (Addgene, Plasmid # 24180) construct was transfected using Lipofectamine2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pEGFP-C1-Centrin-1 plasmid (Addgene, Plasmid # 72641) using Lipofectamine2000 according to the manufacture’s recommendations ...