Labshake search
Citations for Addgene :
51 - 100 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... HMGCR was PCR-amplified out of pCMV-SPORT6-hHMGCR1 (Addgene, 86085) using the forward primer 5’- GTATACTGGATCCGCCGCCACCATGTTGTCAAGACTT-3’ and reverse primer 5’-TCGGAGCTCGAGGTGGCTGTCTTCTTGGT-3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... mRFP with a C-terminal KDEL sequence (ER-mRFP) was PCR amplified out of ER-mRFP (Addgene, 62236) using the forward primer 5’-GGTCGGATCCGCCGCCACCATGGACAGCAAAGG-3’ and the reverse primer 5’-GAGGCACCGGTGTTTAGAGCTCATCTTT-3’ ...
-
bioRxiv - Cancer Biology 2024Quote: Temporally controlled knockdown of Plexin-B2 was achieved with TET-ON lentiviral vectors expressing doxycycline (Dox)-inducible shRNA targeting PLXNB2 (pLKO-Tet-On-PLXNB2–shRNA2; deposited as Addgene #98400). Puromycin selection at 1 µg/ml was used to establish transduced cell lines.
-
bioRxiv - Cancer Biology 2024Quote: ... The mutant cDNAs were transferred by Gateway reaction into pLENTI PGK Neo DEST (Addgene #19067 ...
-
bioRxiv - Cancer Biology 2024Quote: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) 19 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or cytoplasmic tdTomato (LeGo-T2, plasmid #27342, Addgene, USA). For Ca2+-imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μg psPAX2 (Addgene plasmid #12260) in 50 μL Opt-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.3 μg pCMV-VSV-G (Addgene Plasmid #8454), and 1 μg psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Also obtained from Addgene was a plasmid expressing a surface charge probe containing a series of arginine residues linked to a prenylation signal fused with GFP R(+8)-prenyl-GFP (#17274).
-
bioRxiv - Cancer Biology 2024Quote: ... or an empty backbone pLKO.1 control (Addgene plasmid #8453) were used to generate virus and infect OVCAR3 cells or ID8 cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... The FastFUCCI reporter plasmid was obtained from Addgene (#86849). The HMGB2-GFP reporter plasmid was generated as described above ...
-
Self-organization of embryonic stem cells into a reproducible embryo model through epigenome editingbioRxiv - Developmental Biology 2024Quote: For integrating the PB-TRE3G-dCas9-VPR cassette (dCas9-VPR) (Addgene, #63800), cells were transfected using Lipofectamine Stem (Thermo Fisher Scientific ...
-
Self-organization of embryonic stem cells into a reproducible embryo model through epigenome editingbioRxiv - Developmental Biology 2024Quote: The pSLQ1371-sgRNA cassette (Addgene, 121425) was integrated via lentiviral transduction ...
-
bioRxiv - Cell Biology 2024Quote: ... They were used in conjunction with a Cas9 expression vector containing neomycin (G418) resistance transcript (Addgene #98292). H293T cells were transfected with lentivirus packaging plasmids and plasmids carrying either sgRNAs or Cas9 ...
-
bioRxiv - Cell Biology 2024Quote: ... The library was purchased from Addgene (Cat#1000000083) and amplified using the protocol provided by Addgene. The transduced cells were then selected with puromycin (1 µg/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... The library was purchased from Addgene (Cat#1000000083) and amplified using the protocol provided by Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCBASceI plasmid (1.5 µg) (Addgene, 26477)(55) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then cloned into pWPXL vector (Addgene #12257) generating pwpxl-tsTE1 plasmid for overexpression assay in vitro.
-
bioRxiv - Molecular Biology 2024Quote: ... sgRNAs were cloned into LentiGuide-Puro (a gift from Feng Zhang, Addgene: 52963) or a modified form of LentiGuide-Puro in which Cas9 was replaced by GFP-NLS or mCherry-NLS as previously described110 ...
-
bioRxiv - Molecular Biology 2024Quote: ... TCOF1-eGFP was then cloned into pSH-EF-IRES-AtAFB2-mCherry (a gift from Elina Ikonen, Addgene plasmid # 129716) using In-Fusion cloning ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Cancer Biology 2024Quote: ... one expressing Cas9 (Addgene # 52962-LV)16 and one expressing dCas9-KREB (Addgene # 89567)17 ...
-
bioRxiv - Molecular Biology 2024Quote: pPAGFP-C1 was a gift from Jennifer Lippincott-Schwartz (Addgene plasmid # 11910 ; http://n2t.net/addgene:11910; RRID:Addgene_11910) (25) ...
-
bioRxiv - Molecular Biology 2024Quote: ... mCherry-LaminB1-10 was a gift from Michael Davidson (Addgene plasmid # 55069 ...
-
bioRxiv - Molecular Biology 2024Quote: ... One million cells were transfected with the corresponding pools of guide RNAs and with the pX458 plasmid encoding for Cas9 and GFP proteins (48138, Addgene), using lipofectamine 2000 ...
-
Pyruvate kinase M2 regulates Japanese encephalitis virus replication by interacting with NS1 proteinbioRxiv - Microbiology 2024Quote: ... and pEGFP (Addgene #165830). The antibodies used are as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... human H2BC1 and H2AZ2 cDNA were synthesized by Thermo Fisher and cloned into the pCW-Cas9 vector (Addgene #50661) by replacing the Cas9 gene ...
-
bioRxiv - Molecular Biology 2024Quote: We utilized the Gateway destination vector pMK-Cas9 (Addgene plasmid #113743) containing the Cas9 expression cassette and kanamycin resistance marker ...
-
bioRxiv - Molecular Biology 2024Quote: ... along with the entry vector pENTR-PpU6sgRNA-L1L2 (Addgene plasmid #113735), which harboured the PpU6 promoter and sgRNA scaffold ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bacterial clones expressing double-stranded RNA (dsRNA) included the control (empty vector pL4440) sourced from Addgene, Cambridge ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from Nico Dantuma (Addgene plasmid # 23971 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a gift from David Sabatini (Addgene plasmid # 1864; http://n2t.net/addgene:1864; RRID:Addgene_1864),145 shRNA against DOT1L (CGCCAACACGAGTGTTATATT ...
-
bioRxiv - Molecular Biology 2024Quote: ... the HEK293T cells were transfected with the respective constructs along with envelope plasmid (pMD2.G) (Addgene, Cat# 12259), and packaging plasmid (psPAX2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... C-terminally FLAG-tagged ASXL1 p.G646Wfs*12 and p.Y591X were obtained from Addgene. The MSCV-T2A-Puromycin vectors encoding 3xFLAG-tagged full-length ASXL1 and truncated ASXL1 were generated by PCR amplification followed by sub-cloning using Gibson assembly.
-
bioRxiv - Molecular Biology 2024Quote: ... and packaging plasmid (psPAX2) (Addgene, 12260) using Lipofectamine 3000 according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a non-targeting control (F: GCACTACCAGAGCTAACTCAGATAGTACT) were designed using the BROAD Institute design tool and cloned into pLKO.1 vector (Addgene, Cat# 8453), followed by validating the successful insertions using Colony-PCR and Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... They were cloned into lentiCRISPR-v2 (Addgene, Cat# 52961) following the GeCKO protocol with slight modifications64 ...
-
bioRxiv - Microbiology 2024Quote: ... 16ug of pCMVdR 8.2 (ADDGENE, Watertown, MA), and 6.4ug of pCMV-VSV-G (ADDGENE ...
-
bioRxiv - Microbiology 2024Quote: ... To produce lentivirus carrying ACE2 expression cassette 14.2ug of pLENTI-ACE2 (ADDGENE, Watertown, MA, USA), 16ug of pCMVdR 8.2 (ADDGENE ...
-
bioRxiv - Microbiology 2024Quote: Sequences of RhCMV vFcγRs were synthesized as gBlock fragments (IDT) and cloned via Pst1 and BamH1 digest into a p-IRES-eGFP vector (Addgene) providing a unified tapasin signal peptide and resulting in an N-terminal HA-epitope tag upon cleavage of the tapsin signal peptide (55) ...
-
bioRxiv - Microbiology 2024Quote: ACE2+ 293 were transiently transfected with pALPS expressing tat-p2a-rev cassette (Addgene, Watertown, MA, USA). The TZM.bl cell were transiently transfected with Wuhan CoV-2 spike expression plasmid pHDM (BEI resources ...
-
bioRxiv - Microbiology 2024Quote: ... and 6.4ug of pCMV-VSV-G (ADDGENE, Watertown, MA, USA) were mixed in 1.8ml optiMEM ...
-
bioRxiv - Microbiology 2024Quote: ... 782 bp PCR product obtained with primers ymCherryU and ymCherryL and pAG426-GAL-ccdb-ymCherry (a gift from Susan Lindquist (Addgene plasmid # 14155 ...
-
bioRxiv - Cell Biology 2024Quote: FL-NLRC5 (37) was obtained from Addgene (plasmid #37509). The coding sequence of v22 or v23 ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... 782 bp PCR product obtained with primers ymCherryU and ymCherryL and pAG426-GAL-ccdb-ymCherry (a gift from Susan Lindquist (Addgene plasmid # 14155; http://n2t.net/addgene:14155; RRID:Addgene_14155)) ...
-
bioRxiv - Cell Biology 2024Quote: ... a TEAD-reporter construct (8xGTIIC-luciferase, Addgene, Plasmid #34615) and a CMV-Renilla (pGL4.75[hRluc/CMV] ...
-
bioRxiv - Cell Biology 2024Quote: ... into either an mEGFP-C1 (Addgene, 54759) or mEGFP-N1 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... NTF2 domain of G3BP1 variants was cloned into a pET28 MBP-TEV bacterial backbone (Addgene, 69929) with Gibson assembly.
-
bioRxiv - Cell Biology 2024Quote: ... or mEGFP-N1 (Addgene, 54767) plasmid with Kanamycin resistance cassettes ...