Labshake search
Citations for Addgene :
2301 - 2350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... and pCMV-dR8.2 (Addgene plasmid #8455) (gifts from Robert Weinberg ...
-
bioRxiv - Biophysics 2024Quote: ... and pPUR-mUG-sgRNA-Sirius-8XPP7 (Addgene plasmid #121943) were gifts from Thoru Pederson (UMass Chan Medical School ...
-
bioRxiv - Cancer Biology 2024Quote: All cDNAs were either cloned from Addgene plasmids or synthesized as indicated below ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Cancer Biology 2024Quote: ... two sgRNAs were synthesized together with bovine U6 promoter as gene blocks (Integrated DNA Technologies) and cloned using Gibson assembly into LRG2.1T (Addgene, 65656). All inserts were verified by Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Cancer Biology 2024Quote: ... genes were cloned into Doxi-LentiV (derived from Addgene, 80921, 89180 and 71782) vectors and expression was induced using 2 µg/ml doxycycline.
-
bioRxiv - Cancer Biology 2024Quote: ... All cDNAs were cloned into lentiviral constructs derived from LentiV (Addgene 108100), altered to contain internal ribosome entry site (IRES ...
-
bioRxiv - Cancer Biology 2024Quote: ... the promoter of the established TEAD binding reporter (8xGTIIC)(18) (Addgene, 34615) was fused into a construct containing destabilized GFP (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: MARK2 (Addgene, 23404) and MARK3 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... was fused into a construct containing destabilized GFP (Addgene, 138152).
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 plasmids (Addgene, 12260) using PEI reagent (PEI 25000) ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmid encoding the sequence of the cleavage site for Caspase 3 (DEVD) and FLIP-GFP reporter (Addgene# 124428) was digested using the NheI_HF and XmaI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... the NINJ1 cDNA from pENTR223-NINJ1 (DNASU, HsCD00505254) and SLC7A11 cDNA from pENTR223-SLC7A11 (DNASU, HsCD00512940) were individually subcloned into pLVpuro-CMV-N-EGFP (Addgene, #122848) and pLVpuro-CMV-N-mCherry (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... pUltra-Chili (Addgene #48687), LentiV-Cas9-puro (Addgene #108100) ...
-
bioRxiv - Cancer Biology 2024Quote: ... pUltra (Addgene #24129), pUltra-Chili (Addgene #48687) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cloned into the pLenti_CMV_GFP_Blast (Addgene #17445) backbone ...
-
bioRxiv - Cancer Biology 2024Quote: ... LGR2.1 (Addgene #108098) encoding the gRNA targeting the gene of interest ...
-
bioRxiv - Biophysics 2024Quote: ... and pcDNA3/er-(n2)oxStayGold(c4)v2.0 (Addgene plasmid #186296) from Atsushi Miyawaki [10] to tag the mitochondrial matrix and the endoplasmic reticulum ...
-
bioRxiv - Biophysics 2024Quote: ... we obtained the pCSII-EF/mt-(n1)StayGold (Addgene plasmid #185823) and pcDNA3/er-(n2)oxStayGold(c4)v2.0 (Addgene plasmid #186296 ...
-
bioRxiv - Bioengineering 2024Quote: ... EF1α (Addgene plasmid #60058) or a doxycycline-inducible minimal CMV promoter (Addgene plasmid #26431) ...
-
bioRxiv - Bioengineering 2024Quote: ... ELP48 was obtained from Addgene (Addgene Plasmid #68395). Sequencing of ELP48 showed it contained 44 ELP repeats ...
-
bioRxiv - Bioengineering 2024Quote: ... ELP48 was obtained from Addgene (Addgene Plasmid #68395). Sequencing of ELP48 showed it contained 44 ELP repeats ...
-
bioRxiv - Bioengineering 2024Quote: ... 1.463μg of pMD2.G and 3.659μg of psPAX2 (Addgene, Watertown, MA) were transfected using JetPRIME (Polyplus ...
-
bioRxiv - Bioengineering 2024Quote: The guides were integrated into a lentiviral guide expression plasmid (pcmb320, a gift from Michael Bassik (Addgene plasmid 89359). The knockout process was executed via lentiviral transduction ...
-
bioRxiv - Bioengineering 2024Quote: ... or a doxycycline-inducible minimal CMV promoter (Addgene plasmid #26431). EGFP and tdTomato were co-expressed with Aqp1 and Oatp1b3 respectively using an internal ribosome entry site (IRES ...
-
bioRxiv - Cancer Biology 2024Quote: GFP-SMARCA4 (Addgene, 65391) was used for the SMARCA4 mutation clone ...
-
bioRxiv - Cancer Biology 2024Quote: ... were from Addgene (23484 ...
-
bioRxiv - Bioengineering 2024Quote: ... the AKTWT or AKTE17K lentiviral transfer plasmid (Addgene) was cotransfected into HEK293T cells (Takara ...
-
bioRxiv - Bioengineering 2024Quote: The DNA sequences encoding Oatp1b3 (Addgene plasmid #132200) and Aqp1 were amplified using Q5® High-Fidelity 2X Master Mix (New England Biolabs ...
-
bioRxiv - Bioengineering 2024Quote: ... pFA6a-link-yoEGFP-SpHis5 (primers OM-8 and OM-9) (Addgene plasmid #44836), and pBTK522::FAST-PETase 21 (gift from Hal Alper ...
-
bioRxiv - Bioengineering 2024Quote: ... and mCherry from pBT1-proD-mCherry (Addgene plasmid #65823 ...
-
bioRxiv - Bioengineering 2024Quote: ... a viral expression plasmid encoding mKate2 downstream of tandem NF-κB binding sites (37) (Addgene #105173, a gift from Timothy Lu) was co-transfected with gag/pol and env vectors ...
-
bioRxiv - Bioengineering 2024Quote: ... the pMD2.G envelope vector (0.6 μg, a gift from Didier Trono, Addgene #12259) and the receptor- or payload-encoding viral expression plasmids (2.0 μg ...
-
bioRxiv - Cell Biology 2024Quote: ... and non-targeting control (GCGAGGTATTCGGCTCCGCG) were annealed and cloned into lenti-sgRNA Blast (Addgene #104993). E0771 cells lines stably expressing a doxycycline-inducible MRTF-A construct were generated as previously described by sequential transduction with rTTA ...
-
bioRxiv - Cell Biology 2024Quote: IGI-P0492 pHR-dCas9-NLS-VPR-mCherry was a gift from Jacob Corn (Addgene plasmid # 102245 ...
-
bioRxiv - Cell Biology 2024Quote: ... Tom Rapoport (Harvard University, Massachusetts) (Addgene plasmid #86683 and #86678 ...
-
bioRxiv - Cell Biology 2024Quote: ... the full f-tractin-mCherry coding sequence (from C1-F-tractin-mCherry, Addgene #155218) was subcloned into the lentiviral expression vector pLVX-M-puro (Takara 632164) ...
-
bioRxiv - Cell Biology 2024Quote: IGI-P0492 pHR-dCas9-NLS-VPR-mCherry was a gift from Jacob Corn (Addgene plasmid # 102245 ; http://n2t.net/addgene:102245 ; RRID:Addgene_102245).
-
bioRxiv - Cell Biology 2024Quote: ... Erik Snapp (Albert Einstein College of Medicine, present Howard Hughes Medical Institute Janelia Research Campus, Virginia) (Addgene plasmid # 68072), mCherry-CLIMP-63 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The hU6-ngRNA1-hU6-pegRNA2-EF1-α-Puro-2A-RFP-WPRE cassette was amplified from this backbone and ligated into pCMV-PEmax-P2A-hMLH1dn (Addgene plasmid 174828) between SgrDI (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... or NG-ABEmax (Addgene plasmid 124163). For prime editing experiments ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20ug of pCMV-mCherry-Cre (Addgene plasmid 27546) was electroporated into ∼30-40 million cells using the setting 1100V ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1ug of either SF3B1 sgRNA or Rosa26 sgRNA in pLKO.5 Puro-2A-GFP backbone was co-transfected with either 1ug of NG-ABE8e (Addgene plasmid 13849) or NG-ABEmax (Addgene plasmid 124163) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 0.5ug of pegRNAs were co-transfected alone or with 0.5ug ngRNA with 1ug of either pCMV-PE2-P2A-GFP (Addgene plasmid 132776) or pCMV-PEmax-P2A-MLH1dn (Addgene plasmid 174828) ...
-
bioRxiv - Cancer Biology 2024Quote: ... or pCMV-PEmax-P2A-MLH1dn (Addgene plasmid 174828). HEK293T ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cas9 HDR sgRNA sequence was designed using HDR Donor Designer (Horizon Discovery) and ligated into pSpCas9(BB)-2A-GFP (Addgene plasmid 48138) between BbsI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... All pegRNAs were ligated into the pU6-pegRNA-gg-acceptor vector (Addgene plasmid 132777) between BsaI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... GFP (35637) and p53R273H expression vectors (22934) were purchased from Addgene (Watertown, MA, USA). Each plasmid was co-transfected into HEK293T cells with psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each plasmid was co-transfected into HEK293T cells with psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... This fragment was subcloned by restriction (BamHI and XhoI) and ligation into the lenti-vector expression backbone plasmid pLenti-CMV-Blast-empty-(w263-1) (Addgene). Sequence integrity was validated with Sanger sequencing ...