Labshake search

2451 - 2500 of 10000+ citations since 2020

• Clathrin-associated carriers enable recycling through a kiss-and-run mechanism

  Jiachao Xu, et al., bioRxiv - Cell Biology 2024

  Quote: ... The sgRNA sequences were cloned into the pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene).
• ATG5 is dispensable for ATG8ylation of cellular proteins

  Robin Ketteler, et al., bioRxiv - Cell Biology 2024

  Quote: ... [18] and pCMV 3xFLAG-LC3B Q116P G120 (Addgene plasmid # 129289 ...
• Cell crowding induces TRPV4 inhibition and its relocation to plasma membranes, implicating pro-invasive cell volume reduction mechanotransduction pathway

  Xiangning Bu, et al., bioRxiv - Cell Biology 2024

  Quote: ... pCSII-EF-miRFP670v1-hGem(1/110) was a gift from Vladislav Verkhusha (Addgene plasmid # 80006 ...
• ATG5 is dispensable for ATG8ylation of cellular proteins

  Robin Ketteler, et al., bioRxiv - Cell Biology 2024

  Quote: Plasmids used in this study were generated by our lab previously: pCMV 3xFLAG-LC3B G120 (Addgene plasmid # 123094 ...
• Dynamic and decay kinetics of H3 variants in live cells reveal the pivotal role of HIRA/NSD2 in maintaining the distinct H3.3 specific chromatin landscape

  Vishal Nehru, et al., bioRxiv - Cell Biology 2024

  Quote: The cDNAs for H3.1-SNAP-3XHA and H3.3-SNAP-3XHA were cloned sequentially into pMSCV-puro retroviral vectors obtained from Addgene (Plasmid 68469). Briefly ...
• Phosphatases control the duration and range of cAMP/PKA microdomains

  Filippo Conca, et al., bioRxiv - Cell Biology 2024

  Quote: The construct mCherry2-C1 was a gift from Michael Davidson (Addgene plasmid # 54563 ...
• Phosphatases control the duration and range of cAMP/PKA microdomains

  Filippo Conca, et al., bioRxiv - Cell Biology 2024

  Quote: ... all above constructs were purchased from Addgene. The pcDNA3-OMM-AKAR4 sensor and pcDNA3-PKA-mCherry were previously generated in our laboratory(11) ...
• LiveLattice: Real-time visualization of tilted light-sheet microscopy data using a memory-efficient transformation algorithm

  Zichen Wang, et al., bioRxiv - Cell Biology 2024

  Quote: ... the CAAX domain of K-ras tagged with mTagRFP-T was introduced into a safe harbor locus via CRISPR using a donor plasmid developed at the Allen Institute for Cell Science and sourced from Addgene (Plasmid #107580a). We call the resulting cell line CT20 ...
• Biosensor imaging of G protein mediated Signaling Pathways Activated Immediately Downstream of CaSR

  Sergei Chavez-Abiega, et al., bioRxiv - Cell Biology 2024

  Quote: ... DREADD-hM4Di was obtained from Addgene (plasmid # 45548).
• Ephrin Forward Signaling Controls Interspecies Cell Competition in Pluripotent Stem Cells

  Junichi Tanaka, et al., bioRxiv - Cell Biology 2024

  Quote: ... we amplified IgK signal peptide and PDGFR transmembrane domain by PCR from the template of pcDNA3.1-kappa- myc-dL5-2xG4S-TMst (Addgene, 73206) or pCA-mTmG (Addgene ...
• Endogenous Promotor-Driven Split Nanoluciferase Biosensor for Assessing G Protein Recruitment

  Laura J. Humphrys, et al., bioRxiv - Cell Biology 2024

  Quote: ... The pU6-SacB-scRNA-Cas9-T2A-mCherry plasmid was a gift from Kim Failor (Addgene plasmid # 117070) and pFETCh_Donor (EMM0021 ...
• Genetically Encoded and Modular SubCellular Organelle Probes (GEM-SCOPe) reveal lysosomal and mitochondrial dysfunction driven by PRKN knockout

  Camille Goldman, et al., bioRxiv - Cell Biology 2024

  Quote: ... 5.7ug of pRSV.Rev (Addgene plasmid #12253), and 7.9ug of pMD2.G (Addgene plasmid #12259 ...
• Deubiquitinase JOSD1 tempers hepatic proteotoxicity

  Saheli Chowdhury, et al., bioRxiv - Cell Biology 2024

  Quote: ... HA-Ub plasmid (Addgene, Watertown ...
• PINK1-G411S mutant increases kinase stability and enhances mitochondrial-linked functions

  Filipa B. Gonçalves, et al., bioRxiv - Cell Biology 2024

  Quote: ... The PCR product was further cloned into pGEX-4T-1 (Addgene) in-frame with the N-terminal GST-tagged fusion construct(21) ...
• Centrosome Migration and Apical Membrane Formation in Polarized Epithelial Cells: Insights from the MDCK Cyst Model

  Po-Kai Wang, Keng-Hui Lin, Tang K. Tang, bioRxiv - Cell Biology 2024

  Quote: ... with the pSpCas9(BB)-2A-GFP (PX458) vector (Ran et al., 2013) (648138, Addgene, Watertown, MA) bearing the appropriate targeting sequence:
• H3.3 deposition counteracts the replication-dependent enrichment of H3.1 at chromocenters in embryonic stem cells

  S. Arfè, et al., bioRxiv - Cell Biology 2024

  Quote: ... we co-transfected pB31-H3-SNAP-3xHA plasmids with the pCAGGS-FlpE Vector (Addgene #20733) using Nucleofector Kit 2 (Amaxa ...
• Coordination of protein synthesis and decay in mammalian cells

  Michael Shoujie Sun, et al., bioRxiv - Cell Biology 2024

  Quote: ... pCMV-RosaL6 ELD (Addgene #37198), and pCMV-RosaR4 KKR (Addgene #37199 ...
• Polyamines regulate cell fate by altering the activity of histone-modifying enzymes

  Maya Emmons-Bell, et al., bioRxiv - Cell Biology 2024

  Quote: ... 293T cells were transfected with PEI with the targeting plasmid and pMD2 (Addgene 12259) and psPAX2 (Addgene 12260 ...
• Coordination of protein synthesis and decay in mammalian cells

  Michael Shoujie Sun, et al., bioRxiv - Cell Biology 2024

  Quote: ... hESCs were co-transfected with pZT-C13-L1 (Addgene, #62196) and pZT-C13-R1 (Addgene ...
• Inter-cellular mRNA Transfer Alters Human Pluripotent Stem Cell State

  Yosuke Yoneyama, et al., bioRxiv - Cell Biology 2024

  Quote: ... For pAAVS1-Nst-MCS (Addgene #80487), an AAVS1 targeting vector containing neomycin resistant gene ...
• Inter-cellular mRNA Transfer Alters Human Pluripotent Stem Cell State

  Yosuke Yoneyama, et al., bioRxiv - Cell Biology 2024

  Quote: ... and then integrated into the multi-cloning site of PCR-amplified linearized pAAVS1-P-CAG-mCh (Addgene plasmid #80492), an AAVS1 targeting vector containing puromycin resistant gene ...
• Large transient assemblies of Apaf1 constitute the apoptosome in cells

  Alicia C. Borgeaud, et al., bioRxiv - Cell Biology 2024

  Quote: ... 293FT cells were co-transfected with 1.86 μg psPAX2 (gift from Didier Trono, Addgene #12260), 1 μg VSVG (gift from Bob Weinberg ...
• Genetically Encoded and Modular SubCellular Organelle Probes (GEM-SCOPe) reveal lysosomal and mitochondrial dysfunction driven by PRKN knockout

  Camille Goldman, et al., bioRxiv - Cell Biology 2024

  Quote: ... 22.5ug of transfer vector was combined with 14.7ug of pMDLg/pRRE (Addgene plasmid #12251), 5.7ug of pRSV.Rev (Addgene plasmid #12253) ...
• Genetically Encoded and Modular SubCellular Organelle Probes (GEM-SCOPe) reveal lysosomal and mitochondrial dysfunction driven by PRKN knockout

  Camille Goldman, et al., bioRxiv - Cell Biology 2024

  Quote: All vectors were derived from pFUW (Addgene plasmid #14882). pFUW was linearized using NheI-HF (NEB R3131 ...
• Laminar endocytic machinery revealed by quantitative multiplexed super-resolution imaging

  Tai Kiuchi, et al., bioRxiv - Cell Biology 2024

  Quote: ... human Dynamin2 (#27689) and human AP2μ2 (#27672) were purchased from Addgene. cDNA encoding human AP2β2 (Clone ID ...
• Genetically Encoded and Modular SubCellular Organelle Probes (GEM-SCOPe) reveal lysosomal and mitochondrial dysfunction driven by PRKN knockout

  Camille Goldman, et al., bioRxiv - Cell Biology 2024

  Quote: ... and 7.9ug of pMD2.G (Addgene plasmid #12259) in a 15mL conical tube ...
• Endosomal actin branching, fission and receptor recycling require FCHSD2 recruitment by MICAL-L1

  Devin Frisby, et al., bioRxiv - Cell Biology 2024

  Quote: ... mCherry-RAB5 Q79L (35138, Addgene), FLAG-FCHSD2 (GenScript) ...
• Loss of the lysosomal protein CLN3 modifies the lipid content of the nuclear envelope leading to DNA damage and activation of YAP1 pro-apoptotic signaling

  Neuza Domingues, et al., bioRxiv - Cell Biology 2024

  Quote: CLN3-GFP plasmid was obtained from Addgene (#78110), a kind gift from Dr ...
• Macrophage subtypes inhibit breast cancer proliferation in culture

  Sophia R.S. Varady, et al., bioRxiv - Cell Biology 2024

  Quote: The pLenti6-H2B-mCherry plasmid was purchased from Addgene (89766). MDA-MB-231 and MDA-MB-468 cell lines were transduced with lentiviral plasmid vectors to create stable lines ...
• Replicative senescence is ATM driven, reversible, and accelerated by hyperactivation of ATM at normoxia

  Alexander Stuart, Titia de Lange, bioRxiv - Cell Biology 2024

  Quote: ... plKO.1-TetON-Puro-Hif1a 0819 (Addgene 118704).
• CCDC32 stabilizes clathrin-coated pits and drives their invagination

  Ziyan Yang, et al., bioRxiv - Cell Biology 2024

  Quote: The eGFP-CCDC32(FL, human) fragment in a pEGFP-C1 vector was purchased from Addgene (#110505) and then mutated to be siRNA resistant ...
• The long non-coding RNA NEAT1 regulates the transcriptional landscape of cardiomyocytes

  Priyanka Pant, et al., bioRxiv - Cell Biology 2024

  Quote: GFP nanobody beads were prepared from vector pGEX6P1-GFP-Nanobody (Addgene #61838) as per the protocol.57 The beads were stored in 20% ethanol made in PBS as 1:1 slurry ...
• The long non-coding RNA NEAT1 regulates the transcriptional landscape of cardiomyocytes

  Priyanka Pant, et al., bioRxiv - Cell Biology 2024

  Quote: ... viral packaging plasmid (pspax, Addgene #12260), and viral envelope plasmid (pMD2.G ...
• The long non-coding RNA NEAT1 regulates the transcriptional landscape of cardiomyocytes

  Priyanka Pant, et al., bioRxiv - Cell Biology 2024

  Quote: ... were transfected using Lipofectamine 3000 as per manufacturer’s instructions with plasmids having Cas9 and gRNA (Addgene #97081) and a plasmid having repair template (Addgene #97088 ...
• The long non-coding RNA NEAT1 regulates the transcriptional landscape of cardiomyocytes

  Priyanka Pant, et al., bioRxiv - Cell Biology 2024

  Quote: ... gRNAs were cloned into lenti sgRNA(MS2)_zeo (Addgene #61427) backbone using BsmBI restriction enzyme site ...
• EPLINα controls integrin recycling from Rab21 endosomes to drive breast cancer cell migration

  Niklas Z. Jäntti, et al., bioRxiv - Cell Biology 2024

  Quote: ... Overlap extension PCR was then performed for Eplin α using the pEGFP-Eplinα (Addgene plasmid 40947) as template and the Eplin_F ACGAGCTGTACAAGTC-CGGACTCAGA and Eplin_R CCGGTGGATCCCGGGC primers ...
• The long non-coding RNA NEAT1 regulates the transcriptional landscape of cardiomyocytes

  Priyanka Pant, et al., bioRxiv - Cell Biology 2024

  Quote: We used CRISPR/Cas9 Synergistic Activation Mediator (SAM) strategy to induce upregulation of NEAT1.54 Lentiviral particles were generated from Addgene plasmid #61425 having dCAS9-VP64 and plasmid #61426 containing MS2-P65-HSF ...
• Endogenous Promotor-Driven Split Nanoluciferase Biosensor for Assessing G Protein Recruitment

  Laura J. Humphrys, et al., bioRxiv - Cell Biology 2024

  Quote: ... Myers (Addgene plasmid # 63934). The cDNA encoding the β1AR was a kind gift from Ulrike Zabel (University of Würzburg ...
• Ephrin Forward Signaling Controls Interspecies Cell Competition in Pluripotent Stem Cells

  Junichi Tanaka, et al., bioRxiv - Cell Biology 2024

  Quote: ... or pCA-mTmG (Addgene, 60953), respectively ...
• NRF2-dependent regulation of the prostacyclin receptor PTGIR drives CD8 T cell exhaustion

  Michael S. Dahabieh, et al., bioRxiv - Immunology 2024

  Quote: ... 293T cells were first co-transfected with pCL-Eco and either MIGR1 (GFP control vector, kindly provided by Warren Pear, #27490 Addgene), or MIGR1-PTGIR (custom PTGIR overexpressing vector VectorBuilder) ...
• An Atlas of Protein Phosphorylation Dynamics During Interferon Signaling

  Idoia Busnadiego, et al., bioRxiv - Immunology 2024

  Quote: ... pcDNA-HA-14-3-3β (Addgene #13270), pcDNA-HA-14-3-3σ (Addgene #11946 ...
• Loss-of-function mutations in the dystonia gene THAP1 impair proteasome function by inhibiting PSMB5 expression

  Dylan E. Ramage, Drew W. Grant, Richard T. Timms, bioRxiv - Genetics 2024

  Quote: ... into lentiCRISPRv2 (Addgene #52961). shRNAs were cloned in an analogous manner into the pHR-SIREN-PU6-shRNA-WPRE-PPGK-Puro lentiviral vector (a gift from Paul Lehner ...
• Loss-of-function mutations in the dystonia gene THAP1 impair proteasome function by inhibiting PSMB5 expression

  Dylan E. Ramage, Drew W. Grant, Richard T. Timms, bioRxiv - Genetics 2024

  Quote: ... The resulting plasmid was transfected into HEK-239T cells along with a PX459 (Addgene #48139, kindly deposited by Feng Zhang) plasmid encoding Cas9 and an sgRNA (CTTTCTGCCCACACTAGACA ...
• Genetic modifiers of somatic expansion and clinical phenotypes in Huntington’s disease reveal shared and tissue-specific effects

  Genetic Modifiers of Huntington’s Disease (GeM-HD) Consortium, et al., bioRxiv - Genetics 2024

  Quote: ... Amplicons were cloned into a plasmid for targeting the AAVS1 safe harbor locus (AAVS1-TRE3G-EGFP was a gift from Su-Chun Zhang (Addgene plasmid # 52343 ...
• Genetic modifiers of somatic expansion and clinical phenotypes in Huntington’s disease reveal shared and tissue-specific effects

  Genetic Modifiers of Huntington’s Disease (GeM-HD) Consortium, et al., bioRxiv - Genetics 2024

  Quote: ... Amplicons were cloned into a plasmid for targeting the AAVS1 safe harbor locus (AAVS1-TRE3G-EGFP was a gift from Su-Chun Zhang (Addgene plasmid # 52343; http://n2t.net/addgene:52343; RRID:Addgene_52343)) ...
• Genetic modifiers of somatic expansion and clinical phenotypes in Huntington’s disease reveal shared and tissue-specific effects

  Genetic Modifiers of Huntington’s Disease (GeM-HD) Consortium, et al., bioRxiv - Genetics 2024

  Quote: ... to transfect both the AAVS1 targeting plasmids described above and transcription activator-like effector nucleases (hAAVS1 TALEN Left and Right were gifts from Su-Chun Zhang, Addgene plasmid # 52341 & 52342 ...
• Indels allow antiviral proteins to evolve functional novelty inaccessible by missense mutations

  Jeannette L. Tenthorey, et al., bioRxiv - Evolutionary Biology 2024

  Quote: ... and a virus-matched transfer vector encoding GFP (pALPS-eGFP for HIV/SIV, Addgene # 101323; pQCXIP-eGFP for MLV, (22)) ...
• Indels allow antiviral proteins to evolve functional novelty inaccessible by missense mutations

  Jeannette L. Tenthorey, et al., bioRxiv - Evolutionary Biology 2024

  Quote: Single-cycle viruses were generated from three plasmids: two plasmids for transient expression of the VSV-G pseudotyping envelope protein (pMD2.G, Addgene #12259) and viral gag-pol ...
• An Atlas of Protein Phosphorylation Dynamics During Interferon Signaling

  Idoia Busnadiego, et al., bioRxiv - Immunology 2024

  Quote: ... pEMB52-14-3-3_1_247 (γ) was a gift from the Michael J Fox Foundation MJFF (Addgene #40541); pcDNA-HA-14-3-3β (Addgene #13270) ...
• An Atlas of Protein Phosphorylation Dynamics During Interferon Signaling

  Idoia Busnadiego, et al., bioRxiv - Immunology 2024

  Quote: ... pCS2-HA-14-3-3ε (Addgene #116886), pCS2-HA-14-3-3ζ (Addgene #116888 ...