Labshake search
Citations for Addgene :
2201 - 2250 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and pmGFP11C-Tau (Addgene, #71434), were transfected into naïve N2a cells using Lipofectamine™ 2000 Transfection Reagent (Invitrogen™ ...
-
bioRxiv - Neuroscience 2024Quote: ... the CaMPARI2 gene (1446 bp) was subcloned from pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40 (Addgene 101060, gift from Eric Schrieter)26 into a lentiviral plasmid (pRT050 ...
-
bioRxiv - Neuroscience 2024Quote: ... flanked by homology arms to the CLYB1 genomic locus (Addgene plasmid # 124229), and ribonucleoprotein particles containing the Cas9 nuclease and a site-specific gRNA (Synthego) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The following plasmids were used: pMSCV-Neo-GFP/FOXA1 (Addgene #105506) plasmid and the negative control pMSCV-Neo-GFP/Empty (Addgene #105505 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898 ...
-
bioRxiv - Molecular Biology 2024Quote: ... were then cloned into the pCMV-RBFOX1N-dCas13e-C vector to generate the all-in-one U6-gRNA-CMV-RBFOX1N-dCas13e-C constructs (Addgene #206049 and 206050).
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-DIO-mCherry (50459-AAV5, AddGene) at titer 3.3*10^12gc/ml in the VTA (AP:-3.2 ...
-
bioRxiv - Neuroscience 2024Quote: ... was a gift from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Neuroscience 2024Quote: ... was a gift from Feng Zhang (Addgene plasmid # 42230; http://n2t.net/addgene:42230; RRID:Addgene_42230). The sequence for making sgRNA for mediating CSF2RB targeting was located within the intron 10 of CSF2RB ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (20297-AAV5, AddGene) or pAAV-hSyn-DIO-mCherry (50459-AAV5 ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice were injected bilaterally with a volume of 300nl per side at an injection rate of 100nl/min with pAAV5-hSyn-DIO-hM4D(Gi)-mCherry (44362-AAV5, AddGene), pAAV-hSyn-DIO-hM3D(Gq)-mCherry (44361-AAV5 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-hSyn-DIO-hM3D(Gq)-mCherry (44361-AAV5, AddGene), pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA (20297-AAV5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and pCXLE-hUL (Addgene #27082 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and Aedes aegypti NPYLR7 (Addgene #52392) (Duvall et al. ...
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced from transfected HEK293T cells with packaging vectors (pMD2.G #12259, Addgene, and pCMV-dR8.91, Trono Lab) following the manufacturers protocol (#MIR6605 ...
-
bioRxiv - Genomics 2024Quote: ... GL261 cultures were partially transduced with sgRNA expression lentiviruses with a GFP tag (Addgene 187241)40 ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3′ extension oligos were cloned into pU6-tevopreq1-GG-acceptor (Addgene No.174038) by Golden Gate Assembly as previously described14 ...
-
bioRxiv - Bioengineering 2024Quote: ... inserts were PCR amplified from the epegRNA plasmids and from pCMV-PEmax (Addgene No. 174820) and inserted into the respective backbones (Addgene No ...
-
bioRxiv - Physiology 2024Quote: ... The GCaMP6S sequences were amplified from Addgene plasmid #40753 (59 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cells were transiently transfected with 1 μg of each plasmid expressing GCaMP6s (Addgene #277314.1040753) (Chen et al. ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a hNav1.5 plasmid (Addgene plasmid #145374; http://n2t.net/addgene:145374; RRID:Addgene_145374) was linearized with XbaI ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The CASE Gs protein construct is that designed and optimised by the Schulte lab (Schihada et al., 2021) and were obtained from Addgene. Mammalian mini-Gs constructs were a kind gift from Nevin Lambert (Wan et al. ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: pAAV-EF1a-W56-Linker-PSD95.FingR-eGFP-CCR5TC and pAAV-EF1a-Scr-Linker-PSD95.FingR-eGFP-CCR5TC were generated by replacing the BamHI/CsiI sites of pAAV-EF1a-PSD95.FingR-eGFP-CCR5TC (Addgene #125691) with the PCR products of the gene fragments (Twist Bioscience ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: pAAV_Ef1a-W56-Linker-mScarlet-Gephyrin.FingR-IL2RGTC and pAAV_Ef1a-Scr-Linker-mScarlet-Gephyrin.FingR-IL2RGTC were generated by replacing the NcoI/BstEII sites of pAAV-EF1A-mScarlet-Gephyrin.FingR-IL2RGTC (Addgene #125695) with the PCR products of the gene fragments (Twist Bioscience ...
-
bioRxiv - Biochemistry 2024Quote: ... Step one assembly reactions were set up to obtain the vectors pACEBac1-POMP-PAC1-PAC2-PAC3-PAC4 (Addgene plasmid #XXXX), pACEBac1-PSMA1-PSMA2-PSMA3-PSMA4 ...
-
bioRxiv - Physiology 2024Quote: ... pcDNA-mC/EBPb (#49198, Addgene, Watertown, MA, USA), pSV Sport PPAR gamma 1 (#8886 ...
-
bioRxiv - Physiology 2024Quote: ... and a pharyngeal fluorescence selection marker pCFJ90 (Addgene 19327) were injected into N2 young adults ...
-
bioRxiv - Plant Biology 2024Quote: ... for C-terminal fusions we used pGADCg and pGBKCg (gift from Peter Uetz, Addgene plasmids #20161 ...
-
bioRxiv - Plant Biology 2024Quote: ... For N-terminal fusions with the GAL4-activation or -binding domains the vectors pGADT7-GW and pGBKT7-GW (gift from Yuhai Cui, Addgene plasmids #61702 ...
-
bioRxiv - Physiology 2024Quote: ... and cloned into Cas9/GFP expressing vector (pX458 from Addgene #48138). The sequence (CATAACTGGATATTCTGTAA ...
-
bioRxiv - Bioengineering 2024Quote: ... and inserted into the respective backbones (Addgene No. 187181 and 117182) using HiFi DNA Assembly Master Mix [New England Biolabs (NEB)] ...
-
bioRxiv - Bioengineering 2024Quote: ... ACE2 plasmid is from Addgene (Cat#1786). All the other plasmids used in this study are cloned by following the standard protocol of Infusion HD (Takara).
-
bioRxiv - Cancer Biology 2024Quote: ... were cloned in the TLCV2 lenti-vector (Addgene #87360). Lentiviruses were produced by co-transfection of HEK293FT cells (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (Addgene #12259) plasmids encompassing the envelope glycoprotein VSV-G (vesicular stomatitis virus G protein) ...
-
bioRxiv - Cancer Biology 2024Quote: ... the shRNA constructs were packaged into second-generation virus particles using psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pMD2.G (Addgene #12259) into HEK293T cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... with the lentiviral expression vector TLCV2 with the psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Bioengineering 2024Quote: oROS-HT variants were all cloned based on the pC1 plasmid backbone from pC1-HyPer-Red (Addgene ID: 48249). Primers for point mutations or fragment assembly required to generate the oROS-HT screening variants were designed for In Vitro Assembly cloning (IVA ...
-
bioRxiv - Bioengineering 2024Quote: oROS-HT variants were cloned based on the pC1 plasmid backbone from pC1-HyPer-Red (Addgene ID: 48249). Primers for point mutations or fragment assembly required to generate the oROS-HT screening variants were designed for In Vitro Assembly cloning (IVA ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... and pYFJ16-LplA(W37V) (for E. Coli expression; Addgene plasmid # 34838) were gifts from Alice Ting ...
-
bioRxiv - Bioengineering 2024Quote: ... pCAG-Archon1-KGC-EGFP-ER2-WPRE (Addgene; #108423), using the methods above ...
-
bioRxiv - Biochemistry 2024Quote: ... a gift from Marco Herold (Addgene plasmid #70183) via HiFi assembly ...
-
bioRxiv - Biochemistry 2024Quote: We also constructed pFGH1-UTG-mTagBFP2 as empty vectors by inserting PCR-amplified mTagBFP2 from pLKO.1 - TRC (a gift from Timothy Ryan; Addgene plasmid #191566) into digested backbone from pFGH1-UTG ...
-
bioRxiv - Biochemistry 2024Quote: ... The pOPIN-B vector was used for recombinant PLpro expression and was a gift from Ray Owens (Addgene plasmid # 41142). All oligos used in this study were ordered from IDT ...
-
bioRxiv - Biochemistry 2024Quote: ... a gift from John Gearhart (Addgene plasmid #43914; http://n2t.net/addgene:43914; RRID:Addgene_43914), pMSCV-puro (Dickins et al ...
-
bioRxiv - Biochemistry 2024Quote: ... a gift from John Gearhart (Addgene plasmid #43914 ...
-
bioRxiv - Biochemistry 2024Quote: ... the BREP gene was amplified from our previously described pcDNA3-BREP plasmid (Addgene, Cat. # 172337)28 using Taq DNA polymerase under a previously established error-prone condition.55 The resulting mutated genes were then subcloned into a pBAD/His B plasmid using Gibson assembly.56 E ...
-
bioRxiv - Biochemistry 2024Quote: Individual expression clones are detailed in Table S2 and are available from Addgene. Protein expression and purification summaries are detailed in Table S3 and deposited in Zenodo37.