Labshake search
Citations for Addgene :
2151 - 2200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... pDR274 plasmid (Addgene; #42250) was linearised with the BsaI restriction enzyme (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... Reticulon4a-eGFP was kindly provided by Gia Voeltz (Addgene 61807).52
-
bioRxiv - Cell Biology 2024Quote: ... The sequence was synthesized as oligos with BbsI overhangs and was cloned into the BbsI sites of pX459V2.0-HypaCas953 (Addgene 108294). The homology repair template to make endogenous APMAP-mNeonGreen was made from two synthesized 800-bp homology regions gene fragments (Twist Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... and 20 µg of the retroviral vectors pMXs-Oct4 (#13366, Addgene), pMXs-Klf4 (#13370 ...
-
bioRxiv - Cell Biology 2024Quote: ... pMXs-Klf4 (#13370, Addgene) and pMXs-Cherry (pMX-2A-CH ...
-
bioRxiv - Cell Biology 2024Quote: ... BFP ER-reporter was purchased from Addgene (49150).
-
bioRxiv - Cell Biology 2024Quote: ... and 3.75 μg pMD2.G (Addgene, 12259). Viral supernatant was cleared of cells by filtering with 0.2 μm filter membrane (Pall Corporation 4612) ...
-
bioRxiv - Cell Biology 2024Quote: ... pAW91.dCas9 (Addgene, 104372) and pAW90.dCas9-YY1 (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: sgRNAs targeting the C-terminal end of REG1A were designed and cloned into pSPgRNA (Addgene #47108) according to the protocol from Ran et al ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transduced with lentiCas9-Blast lentiviral particles (Addgene #52962-LV) at a multiplicity of infection of approximately 0.1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral particles of the genome-wide gRNA library Brie (Addgene #73633) were generated according to standard protocols (Doench et al. ...
-
bioRxiv - Bioengineering 2024Quote: ... The full-length SpRY CBE4max construct was purchased from Addgene (Plasmid #139999). The full-length SpRY ABE8e plasmid was generated through Gibson Assembly of gBlock Gene Fragments (Integrated DNA Technologies ...
-
bioRxiv - Bioengineering 2024Quote: The plasmid encoding the U6-sgRNA expression cassette was obtained from Addgene (#47108). The full-length SpRY CBE4max construct was purchased from Addgene (Plasmid #139999) ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... hSyn_hM4D(Gi)_mCherry (4,59*109/ul; Addgene plasmid #50475); hSyn_DiO_hM4Di-mCherry (4.2*1010/ul ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... hSyn_DiO_hM4Di-mCherry (4.2*1010/ul; Addgene plasmid #44362)] were injected into RE (150 nl ...
-
bioRxiv - Biochemistry 2024Quote: ... It was cloned into 438-B vector (kind gift from Scott Gradia; Addgene plasmid # 55219 ...
-
bioRxiv - Biochemistry 2024Quote: ... It was cloned into 438-B vector (kind gift from Scott Gradia; Addgene plasmid # 55219; http://n2t.net/addgene:55219; RRID:Addgene_5521982) in frame with an N-terminal 6xHis tag followed by a TEV cleavage site ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... and then recombined into the destination vector pLenti CMV Blast DEST (706-1, Addgene) plasmid using the Gateway cloning method.
-
bioRxiv - Biochemistry 2024Quote: Homo sapiens TTLL8 (res. 39-585) was cloned into pCoofy28 (Addgene plasmid #44004) by sequence-specific ligation with RecA (43) ...
-
bioRxiv - Biochemistry 2024Quote: ... and packaging plasmids (psPAX2, Addgene #12260; pMD2.G, Addgene #12259) was prepared in serum-free media (Opti-MEM™ ...
-
bioRxiv - Biochemistry 2024Quote: ... and packaging plasmids (psPAX2, Addgene #12260; pMD2.G, Addgene #12259) was prepared in serum-free media (Opti-MEM™ ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: RNH1-KO K562 cells were infected with lentiviruses expressing ANG (pLenti CMV Blast GFP-ANG) or the empty vector pLenti CMV Blast DEST (706-1, Addgene) as previously described 52 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1.7 μg psPAX2 (Addgene #12260), 48.8 μg PEI (1 μg/μL ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.85 μg pMD2.G (Addgene #12259), 1.7 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2xStrep-Flag-FOXA1-HA was introduced to pINDUCER21 (Addgene #46948) to generate pINDUCER21_FOXA1 by Gateway cloning protocol (Thermo).
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... The pET28a-TRBP was purchased from Addgene (Addgene plasmid # 50351). The pET28a-TRBP plasmid was transformed into E ...
-
bioRxiv - Biochemistry 2024Quote: ... The pET28a-TRBP was purchased from Addgene (Addgene plasmid # 50351). The pET28a-TRBP plasmid was transformed into E ...
-
bioRxiv - Biochemistry 2024Quote: ... packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455) in a 6:4:1 ratio using PEI-max (Polysciences #24765-100) ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... the human Angiogenin (ANG) full coding sequence (ORIGEN RC 208874) was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene). The medium was replaced 16h after transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259). Medium was changed 16 h after transfection and lentiviral particles were harvested 24 h later ...
-
bioRxiv - Cancer Biology 2024Quote: mEGFP and mEGFP-ALKBH5 sequences were first ligated into the AgeI and PSTI restriction sites of a pLJM1 plasmid (Addgene). Lentiviral particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1-mEGFP or pLJM1ALKBH5 plasmids with 6 μg of psPAX2 packaging plasmid and 2 μg of pMD2.G envelope plasmid (Addgene) ...
-
bioRxiv - Cancer Biology 2024Quote: ... ALKBH5 shRNA was generated by ligation of oligonucleotides into the AgeI and EcoRI restriction sites of pLKO.1 (Addgene plasmid #8453). Lentiviral-shRNA particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1 vector containing the shRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspended in a sterile 0.9% NaCl solution/plasmid mix containing 10 μg of pT3-MYC (Addgene #92046), 10 μg of pX330-p53 (Addgene 59910) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg of psPAX2 packaging plasmid (Addgene plasmid #12260), and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and packaging plasmids (psPAX2, Addgene). Viral supernatant was collected after 48 h and filtered through a 0.45µm filter ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell lines were transiently transfected with a membrane-targeted fluorescent protein (glycosylphosphatidylinositol-anchored eGFP, Addgene #32601) using a TransIT-X2 transfection kit (Mirus) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus was produced by transfecting HEK293T cells with viral envelope (VSVG, Addgene) and packaging plasmids (psPAX2 ...
-
bioRxiv - Cancer Biology 2024Quote: 1099 or pB3 cell line derivatives expressing pCDH-EF1-Luc2-P2A-tdTomato (Plasmid #72486, Addgene) were resuspended at a concentration of 1×106/mL in culture medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLenti.PGK.blast-Renilla_Luciferase vector from Reuben Shaw (Addgene plasmid # 74444; http://n2t.net/addgene:74444; RRID: Addgene_74444) was used to label cell lines and organoid cultures for in vitro cell viability measurements ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Lenti-iCas9-neo vector from Qin Yan (Addgene plasmid # 85400 ...
-
bioRxiv - Cancer Biology 2024Quote: ... while the sgRNA was delivered separately using the LentiGuide-puro vector from Feng Zhang (Addgene plasmid #52963).
-
bioRxiv - Cancer Biology 2024Quote: ... the Lenti-iCas9-neo vector from Qin Yan (Addgene plasmid # 85400; http://n2t.net/addgene:85400; RRID: Addgene_85400) was used to express a doxycycline-inducible Cas9 in cell lines ...
-
bioRxiv - Cancer Biology 2024Quote: ... and non-targeting control sgRNAs (GTTCCGCGTTACATAACTTA; CTCTGGCTAACGGTACGCGTA) were cloned into lentiCRISPRv2 vector from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLenti.PGK.blast-Renilla_Luciferase vector from Reuben Shaw (Addgene plasmid # 74444 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CTCTGGCTAACGGTACGCGTA) were cloned into lentiCRISPRv2 vector from Feng Zhang (Addgene plasmid # 52961; http://n2t.net/addgene:52961; RRID: Addgene_52961). The protein depletion efficiency of sgRNA of each target was verified individually by Western Blotting (WB ...
-
bioRxiv - Cancer Biology 2024Quote: ... or Blasticidin resistance (from pCW-Cas9-Blast; Addgene, #83481) by In Fusion cloning into pDual_dsCas9_Venus digested with BamHI-HF (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Therefore, we used lipofection (Lipofectamine 3000, #L3000001) of HEK293T cells to package psPAX2 (Addgene, #12260), pMD2.G (Addgene ...