Labshake search
Citations for Addgene :
2251 - 2254 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... We first generated a CRISPRi cell line by transducing J-Lat A72 with the vector lenti-EF1a-dCas9-KRAB-Puro (Addgene #99372, a gift from Kristen Brennand). After selecting with puromycin-containing media (1 μg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral vectors expressing the cDNA of wild-type c-Myc and GFP in the murine stem cell virus backbone were purchased from Addgene (MSCV-Myc-IRES-GFP, Plasmid #18770). Doxycycline-inducible constructs were obtained by cloning c-Myc cDNA into GC385-S backbone ...
-
bioRxiv - Microbiology 2024Quote: ... HEK293T cells were cultured in 10-cm dishes and transiently transfected with 9 µg lentiviral plasmid pLV-ER-GFP (Addgene, 80069, a gift from Pantelis Tsoulfas), 8 µg pCMV-dR8.91 ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...