Labshake search
Citations for Addgene :
1851 - 1900 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Non-GFP expressing ZT cells were obtained by sorting out non-fluorescence ZT cells and they were subsequently immortalized by transfecting them with SV40 T-antigen expressing plasmid (Addgene).
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... HEK293T cells were co-transfected with pLenti-CRISPRv2 plasmids and the packaging plasmids pPAX2 (Addgene #12260, deposited by Didier Trono) and pMD2.G (Addgene #12559 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Molecular Biology 2023Quote: Vero E6-TMPRSS2 cells were generated by transduction with a 2nd generation lentiviral vector pLEX307-TMPRSS2-blast (Addgene plasmid #158458) and selected for two weeks in DMEM containing 20 µg/mL of Blasticidin (Cat# SBR00022 ...
-
bioRxiv - Cell Biology 2023Quote: After production of recombinant lentiviruses in HEK293T cells by co-transfection of the pLentiCRISPRv2 constructs with pMD2.G and psPAX2 (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... the plasmid to be packaged was co-transfected into HEK293T cells with a rep/cap containing plasmid pUCmini-iCAP-PHP.eB (Addgene #103005) and the helper plasmid pAdDeltaF6 (Addgene #112867) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected using standard polyethylenimine (PEI) protocols in suspension at time of seeding with 30 ng reporter HRELuc (Addgene #26731 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells carrying inducible Cas9 and the WNK1 sgRNAs were infected with either EGFP-expressing lentiviral particles (FUGW-EGFP, Addgene #14883) or FUGW-mRuby3-expressing lentiviral particles (34) ...
-
bioRxiv - Cell Biology 2024Quote: ... 700,000 HEK293T cells were seeded onto a 6-well plate and 24 hours later transfected with 200 ng pMD2.G (Addgene), 400 ng psPAX2 (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: HEK293FT cell were transiently co-transfected with the fluorescent citrate sensor Citron (CMV-Citron1, AddGene #134303 (Zhao et al., 2020)) and either pcDNA3.1 carrying the WT or mutant genes T227M ...
-
bioRxiv - Microbiology 2024Quote: ... BHK-21/WI-2 culture supernatants were filtered (0.22 μm) and used to inoculate 293T cells that had been transfected 24 h previously with pMD2.G (Addgene 12259). At 24 h post-inoculation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviruses were generated by transfecting sub-confluent HEK293T cells along with the lentiviral vector and packaging vectors pCMV-VSV-G (Addgene, Cat. 8454, RRID: Addgene_8454) and psPAX2 (Addgene ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: Cells were seeded in 12-well plates and transfected at 50-70% confluence with 0.5 µg/well TOPflash (Addgene, #12456) and 0.3 µg pRL-TK (Promega ...
-
bioRxiv - Cell Biology 2024Quote: The monoclonal SK-N-DZ SCLYKO cell line was transduced with Toronto KnockOut (TKO) CRISPR Library - Version 3 (Addgene, 90294) at MOI of 0.3 ...
-
bioRxiv - Microbiology 2024Quote: ... and SV2B K562-DCSIGN KO cell lines were generated via nucleofection with top-ranking sgRNAs (Table S4) cloned into px458 (Cat# 48138, Addgene). One million cells resuspended in 100 μL of SF Cell Line Nucleofector solution (Lonza V4XC-2012 ...
-
bioRxiv - Microbiology 2024Quote: K562-Cas9-Blast cells (provided by Andreas Puschnik, Chan Zuckerberg Biohub, San Francisco) were generated by transduction with lentiCas9-Blast (Cat# 52962, Addgene) and selection with blasticidin as described previously [38] ...
-
bioRxiv - Molecular Biology 2024Quote: We transfected HAP1 cells with 2 µg of pX330 U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230; (Cong et al, 2013)) containing LAD-specific or AVVS1-specific guide RNAs ...
-
bioRxiv - Molecular Biology 2024Quote: ... were generated by lentiviral transduction of R3.8Cas9 cells with the corresponding single guide RNAs (sgRNAs) cloned in vector pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene #67974) as previously described [26] ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK-293T cells were co-transfected with lentivirus construct encoding Cas9 and a sgRNA targeting exon 7 of ATG5 (LentiCRISPRv2-ATG5; Addgene, 99573 [17] ...
-
bioRxiv - Genetics 2024Quote: ... The resulting plasmid was transfected into HEK-239T cells along with a PX459 (Addgene #48139, kindly deposited by Feng Zhang) plasmid encoding Cas9 and an sgRNA (CTTTCTGCCCACACTAGACA ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
bioRxiv - Systems Biology 2024Quote: ... cells were transfected with a pCMV-Grx1roGFP2-Hygromycin vector then the stable cell lines were selected with hygromycin B (the vector was modified from pEIGW-Grx1-roGFP2, 64990, Addgene). The information obtained from Grx1-roGFP2 fluorescence is not utilized in this work.
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... monolayers of HCT116 cells incubated at 37 °C and under 5% CO2 were transfected with RedTrackCMV (vector control; #50957, Addgene) or RedTrackCMV-LC3B (RedTrackCMV containing the gene encoding LC3B ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus was generated in HEK-293T cells by transfection with packaging and envelope plasmids pMDLg/pRRE (Addgene # 12251, RRID: Addgene_12251), pRSV-rev (Addgene #1225 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus was generated in HEK-293T cells by transfection with packaging and envelope plasmids pMDLg/pRRE (Addgene # 12251, RRID: Addgene_12251), pRSV-rev (Addgene #1225 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transformed with pET28a plasmid encoding the amber mutant TTC5 and the pEVOL-pBpF plasmid (Addgene plasmid #31190). Cells were grown at 37 °C in LB containing 50 μg/mL kanamycin and 25 μg/mL chloramphenicol and induced with 0.2 % L-arabinose at an A600 of 0.3 for 30 min followed by a second induction with 0.2 mM IPTG at an A600 of ∼0.6 at 16 °C overnight ...
-
bioRxiv - Immunology 2024Quote: ... 2×106 HEK293T cells were transfected simultaneously with 20µg of a pNL4.3Balenv plasmid and 10 µg of a pMIGw plasmid (Addgene cat#12282). Cells (2×106 cells per T75 flask ...
-
bioRxiv - Microbiology 2024Quote: A549-Cas9 stable cells were transduced at a low MOI (∼0.3) with Human CRISPR Knockout Pooled Library Brunello (Addgene, #73178) [35] ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentivirus was produced by co-transfecting HEK293T cells with pCMV-VSV-G (a gift from Bob Weinberg; Addgene plasmid #8454), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Molecular Biology 2024Quote: ... One million cells were electroporated (Neon Electroporation System MPK5000) with 0.66 μg of each of the following plasmids: (i) pDRGFP (Addgene 26475), (ii ...
-
bioRxiv - Microbiology 2024Quote: ... A549 cells were transfected with 2 µg DNA of ARF1-GFP48 (ARF1-GFP was a gift from Paul Melancon, Addgene plasmid #39554 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... . The 293 T cells were transfected with pLVX-TFAP2B-3×Flag together with psPAX2 and pMD2.G lentiviral packaging systems (Addgene) to generate TFAP2B stably overexpressed cell lines.
-
bioRxiv - Molecular Biology 2024Quote: ... Positive cells were subsequently transduced with a construct expressing KRAB-dCas9 linked to BFP under a TRE3G promoter (Addgene, #85449). The cells were selected by fluorescent cell sorting (FACS ...
-
bioRxiv - Microbiology 2024Quote: IRF1 and STAT1 polyclonal KO cell lines were generated using single guide RNAs (sgRNA) cloned into pLentiCRISPR V2 (Addgene #52961) packaged using pSPAX2 and pMD2G ...
-
bioRxiv - Biophysics 2024Quote: ... lentiviruses for Cas9 and guide RNA delivery were produced by transfecting 293TX cells with packaging vectors (pCMV-VSV-G, #8454; psPAX2, #12260; Addgene) and the pLenti-CRISPR DNA vector (#52961 ...
-
bioRxiv - Cell Biology 2024Quote: WT (M63.1: pMG-INV 36: iCas9.302) abl pre-B cells with chromosomally integrated pMG-INV reporter and pCW-Cas9 (Addgene #50661) were described previously (29) ...
-
bioRxiv - Immunology 2024Quote: ... lentiviral particles were produced by co-transfection of 2 × 106 293T cells with 5 μg of LentiCRISPRv2GFP plasmid (Addgene # 82416) expressing the gRNA targeting the gene of interest or non-targeting control (CTRL ...
-
bioRxiv - Immunology 2024Quote: ... The AAVS1-mScarlet donor template vector was introduced in the cells along with an AAVS1-targeting Cas9 PX458 (#48138-Addgene) plasmid containing the sgRNA sequence ...
-
bioRxiv - Developmental Biology 2024Quote: Approximately 1 × 106 trisomic proband iPS cells were transiently co-transfected with a plasmid that expressed a gRNA (Addgene: 229941) specific to the chromosome 8 centromere region and the mCherry-KNL1Mut-dCas9 plasmid ...
-
bioRxiv - Bioengineering 2024Quote: ... NIH/3T3 cells were lentivirally transduced with the viral supernatant produced in Lenti-X 293T cells after transfection with the following plasmids: cargo plasmid containing Cas9 and EGFP (pL-CRISPR.EFS-GFP, Addgene #57818), VSV-G envelope containing plasmid (pMD2.G ...
-
bioRxiv - Biophysics 2024Quote: ... HEK 293 PKD2null cells were electro-transfected with PKD1 sgRNAs (caccGCATAGGTGTGGTTGGCAGC and aaacGCTGCCAACCACACCTATGC) with the All-in-one Cas9 plasmid (Addgene). Cells generated from single cell clones were selected after 4 weeks of expansion under puromycin selection in a 96-wells plate ...
-
bioRxiv - Genomics 2024Quote: ... lentivirus containing our gRNA of interest was produced from HEK-293T cells transfected with the gRNA-containing plasmid mixed with the packaging vectors pVSVG (plasmid no. 8454; Addgene) and psPAX2 (plasmid no ...
-
bioRxiv - Biophysics 2024Quote: 50-60% confluent U2OS cells were plated on 35 mm dishes and transfected the next day with the virus of interest (Addgene #116934 ...
-
bioRxiv - Cancer Biology 2024Quote: 786-O and HKC-8 cells were transfected with 2.5µg of pcDNA3.1-HA (Addgene plasmid #128034; gift from Oskar Laur) and HA-EPAS1/HIF2A-pcDNA3 (Addgene plasmid #18950 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected (same protocol as above) with plasmid eSpCas9-ATP1A1-G2-Dual-sgRNA (Addgene #86612, gift from Yannick Doyon) which enabled for marker-free co-selection for NHEJ-based gene editing(65) ...
-
bioRxiv - Cell Biology 2024Quote: PS-DKO cells were transfected with the truncated mature form of SREBP2 (2xFLAG-SREBP2, aa 1-482, Addgene plasmid #26807), which is targeted to the nucleus where it activates cholesterol biosynthesis gene programs ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells at 80-90% confluence were transfected with 2.5-5 µg of plasmid DNA (pcDNA3-EGFP-Cdc42-wt, Addgene #12975) or 50-100 nM siRNA (CdGAP Smart pool or Cdc42 siRNA ...
-
bioRxiv - Bioengineering 2024Quote: Lentiviral particles were generated in HEK-293T cells by transfecting them with three separate packaging plasmids gifted by Didier Trono: pRSV-Rev (Addgene plasmid #12253 ...
-
bioRxiv - Cancer Biology 2024Quote: 3x105 parental and clonally derived Cas9-expressing OCI-AML2 or PANC-1 cells were infected with pXPR_011 (Addgene Plasmid #59702) virus as described above ...
-
bioRxiv - Cell Biology 2024Quote: Lentiviral vectors (expressing Cas9 and scramble gRNA 5’-GTGTAGTTCGACCATTCGTG or gRNA against human LC3B 5’-CATCCAACCAAAATCCCGGT (pLV[CRISPR]-hCas9:T2A:Bsd-U6>hMAP1LC3B[gRNA#954]) (Vectorbuilder) were transfected into HEK293T cells with plasmids psPAX2 (Addgene #12260) and pCMV-VSV-G (Addgene #8454 ...