Labshake search
Citations for Addgene :
2001 - 2050 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 72hrs post transfection cells from both siMCU and siNT conditions were transfected with 1ug of eGFP-NFAT2 overexpression plasmid (Addgene#24219) using Lipofectamine 2000 reagent according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral particles were prepared in HEK293T cells using standard calcium-phosphate transfection of the lentivector with packaging plasmids pMD2.G (Trono lab, Addgene #12259) and pCMV-dR8.74 (Trono lab ...
-
bioRxiv - Molecular Biology 2022Quote: ... Spike protein pseudotyped luciferase-expressing lentivirus preparation, HEK293T cells were transfected with FUW-RLuc-T2A-PuroR(Kanarek et al., 2018) (Addgene, MA), psPAX2 and pUNO1-SARS2-S (D614G ...
-
bioRxiv - Cell Biology 2024Quote: ... hTERT-RPE1 cells were edited to create a functionally null puromycin resistance cassette through delivery of two pX461 vectors (Addgene #48140) containing the appropriate guide RNA (gRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single clones were obtained by fluorescence-activated cell sorting and functionally tested for Cas9 activity using a lentiviral reporter pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W (Addgene #67980). PPM1D-mutant cell lines were generated using the RNP-based CRISPR/Cas9 delivery method using a single sgRNA (GCTAAAGCCCTGACTTTA) ...
-
bioRxiv - Genomics 2024Quote: ... we nucleofected five million cells with five µg of spCas9/sgRNA-expression plasmids (pX330-U6-Chimeric-BB-CBh-hSpCas9, Addgene #42230) by Nucleofector 2b ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentivirus was generated by co-transfection of HEK293T cells with destination vector plasmid DNA and the packaging plasmids pMDLg/pRRE (Addgene, 12251), pRSV-Rev ...
-
bioRxiv - Cancer Biology 2024Quote: ... B7GG cells were transfected by Lipofectamine 3000 (Thermo Fischer) with rabies virus genomic vectors RabV CVS-N2cΔG-eGFP (Addgene plasmid #73461) or SAD-B19ΔG-eGFP (modified from Addgene plasmid # 32634) ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Physiology 2024Quote: ... Pparg1 or Pparg2 in NIH-3T3 cells was performed by transfecting pcDNA3.1(-) rat C/EBP alpha (#12550, Addgene, Watertown, MA, USA), pcDNA-mC/EBPb (#49198 ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 x 106 cells were transfected using the calcium phosphate precipitation method (Salmon and Trono, 2007) with 6 μg pMD2.G (Addgene #12259), 15 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2024Quote: HEK293T cells were transfected with 3 µg of pmirGLO plasmid containing the 3’UTR of Zc3h12a or Tnf (Addgene plasmid 207127) (7 ...
-
bioRxiv - Molecular Biology 2024Quote: ... To generate MPST-/- HeLa cells single guide RNAs (sgRNAs) against MPST (fwd: CACCGGCGTCGTAGATCACGACGT, rev: AAACACGTCGTGATCTACGACGCC) were subcloned into the plentiCRISPR V1 (Addgene 52963). Subcloned plasmids were co-transfected into HEK293T cells with lentiviral packaging vectors ...
-
bioRxiv - Neuroscience 2024Quote: iPS cells were transduced with a Lentivirus expressing GFP under activation of WNT signaling (Lentiviral-Top-dGFP reporter, Addgene plasmid #14715). Puromycin (1μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... MEFs and MDA-MB-231 cells were stably modified using BFP and DN-KASH expression plasmids in a doxycycline-inducible Piggybac plasmid backbone (Addgene #187019). For lentiviral modifications ...
-
bioRxiv - Immunology 2024Quote: ... MP5-Hif1α KO lines were made via transducing MP5 cells with sgHif1a or sgNT cloned into lentiCRISPRv2-GFP (Addgene, plasmid #82416) and sorting for GFP.
-
bioRxiv - Cancer Biology 2023Quote: ... we used HEK293T cells co-transfected with lentiviral constructs encoding the target sgRNAs and second-generation packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: Cas9-expressing Ctgf-P2A-GFP C2C12 cells were infected with validated lentiviral particles generated from a whole-genome CRISPR-Brie library (Addgene, #73632). After 24 hours ...
-
bioRxiv - Immunology 2023Quote: Retrovirus were packaged by co-transfection of Phoenix-Eco cells with indicated plasmid and helper plasmid pCL-Eco (Addgene, Cat# 12371) using calcium phosphate precipitate mediated transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Neuroscience 2023Quote: ... An additional round of CRISPR/Cas9 genome editing was performed on one clonal cell line to further disrupt the coding region of endogenous Scn9a using recombinant pX458 plasmid (pSpCas9-2A-GFP; Addgene #48138) and a gRNA targeting the in-frame deletion (Scn9a ...
-
bioRxiv - Neuroscience 2023Quote: ... Neuro2a cells stably expressing the CVS-N2c glycoprotein (N2A-N2cG_02 cells) were transfected with the barcoded N2c library along with helper plasmids pCAG-N2cN (Addgene cat. # 100801), pCAG N2cP (Addgene cat ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles for cas9 and HSP90-alpha were produced using HEK293T cells by con-transfection of transgene plasmid and pMD2.G (Addgene# 12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviruses were made by Lipofectamine 2000-based co-transfection of 293FT cells with the respective lentiviral expression vectors and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: High-titre lentiviral supernatants were produced by transient transfection of 293T/17 cells with second-generation packaging/envelope vectors pRRE (Addgene #12251), pREV (Addgene #115989) ...
-
bioRxiv - Microbiology 2023Quote: ... The functionality of T7 polymerase and VSVG expression in 293FT-T7pol-VSVG cell lines was determined using pUC19-T7pro-IRES-EGFP (Addgene, 138586) or through the recovery of rVSV virus.
-
bioRxiv - Microbiology 2023Quote: ... The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The primer sequences used in amplifying human and mouse CUL1 and UBE2L3 coding sequences are listed in Table 1 ...
-
bioRxiv - Genomics 2023Quote: ... Lentivirus containing the landing pad sequence was produced by co-transfecting 293T cells at ∼50% confluence with psVSV-G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral vector pLenti-CMV-Puro-DEST containing EGFP-rNLRP1-MYC was transfected into Lenti-X cells together with packaging plasmid psPAX2 (Addgene #12260) and Lentiviral envelope plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Bioengineering 2023Quote: ... Murine Stem Cell Viruses (MSCV) were packaged using Platinum-E cells by co-transfection of MSCV retroviral transfer plasmids with pCL-Eco (Addgene #12371) using X-tremeGENE 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Cell Biology 2023Quote: ... RAW264.7-TLR2-KO cells were generated by CRISPR-Cas9 using the LentiCRISPR-v2 system (kind gift from Dr. Brett Stringer, Addgene#98290) targeting an early PAM site in the Tlr2 coding exon ...
-
bioRxiv - Cancer Biology 2023Quote: Engineering of Luc-tagged HCC1954 cells (HCC1954-Luc) and tumour implantation: the pLenti CMV Puro LUC (w168-1) was purchased from Addgene (#17477) and used in all in vivo experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... integrating lentivirus for both Cas9 and sgRNA was generated by overnight transfection of adherent HEK293 cells with either the Cas9 or sgRNA vector and the packaging vectors psPax (Addgene #1226) and pMD2g (Addgene #12259) ...
-
bioRxiv - Microbiology 2023Quote: ... Puromycin selection was performed until visual inspection showed a pure population of cells express zsGreen (which is part of lentivirus backbone, see plasmid Addgene #204579). At this point all cell stored libraries were frozen until further use.
-
bioRxiv - Neuroscience 2023Quote: ... To express the calcium indicator GCaMP6s in neuronal cell bodies or long-range projection axons either AAV5-Syn-GCaMP6s or AAV1-Syn-GCaMP6s (1−1013 gc/mL; Addgene #100843) was injected into the relevant brain region ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by transfection of HEK-293T cells with lentiCRISPRv2 (sgC15, sgC40 or sgCtrl) and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: U2OS T-REx FLAG-HA-FAM134s stable and inducible cell lines were infected with lentivirus carrying the pCW57-CMV-ssRFP-GFP-KDEL (Addgene #128257). We previously deleted the tetracycline response element ...
-
bioRxiv - Cancer Biology 2022Quote: MCF10A MND1 and PSMC3IP CRISPRi cell lines were generated by cloning sgRNAs into the BbsI site of the pKLV5-U6sgRNA5-PGKPuroBFP (Addgene # 50946), as previously described (Tzelepis et al. ...
-
bioRxiv - Cell Biology 2022Quote: Lentivirus preps were produced in 293FT cells transfected with lentiviral delivery vectors together with second generation packaging system consisting of psPax2 (Addgene 12260), and pMD2.G (Addgene 12259 ...
-
bioRxiv - Cell Biology 2022Quote: All lentiviral productions were done by transfecting 293T cells with equal amount of lentiviral packaging combo (pMDLg/pRRE (Addgene Plasmid #12251), pRSV-Rev (Addgene Plasmid #12253) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viral supernatants were prepared by transfection of HEK293T cells with the vector plasmids and packaging plasmids (psPAX2 Addgene 12259 and pMD2.G Addgene 12260). The transfection was performed with polyethylenimine (PEI MAX Transfection Grade Linear Polyethylenimine Hydrochloride ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lenti-vectors expressing each pair of gRNAs targeting distal enhancers were packaged in 293T cells using pMD2.G (Addgene # 12259) and psPAX (Addgene # 12260) ...
-
bioRxiv - Biochemistry 2022Quote: ... lentivirus was produced by co-transfection of HEK293T cells with a lentiviral vector and the packaging plasmids psPAX2 (Addgene, plasmid #12260) and pMD.2G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell line used for CRISPRi screen was generated by lentiviral transduction of MCF10A TP53-/- cells with lenti-BLAST-dCas9-KRAB (Addgene, #89567) followed by selection with 10 μg/mL blasticidin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cas9-expressing cells were generated as follows: each parental cell line was incubated with lentivirus corresponding to the pLX_311-Cas9 plasmid (Addgene plasmid #96924), encoding the Cas9 protein ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1.iPLK4 and RPE-1.iPLK41-608 cell lines were generated using pLenti-CMV-TetR-Blast lentiviral vector (Addgene, 17492) and selected using Blasticidin (10 µg/mL) ...
-
bioRxiv - Genomics 2022Quote: ... Viral particles were produced by transient transfection of HEK293T cells with the library and packaging plasmids pMD2.G (Addgene no. 12259) as well as psPAX2 (Addgene no ...
-
bioRxiv - Microbiology 2022Quote: ... in DMEM+10% FBS supplemented with 20 μg/ml G418 to select for transduced cells.Selection was repeated for 6 passages and selected cells were expanded into 24 well plates and transfected with pX330-U6-Chimeric_BB-CBh-hSpCas9 (#42230; Addgene, Watertown, MA) by Trans IT LT-1 (Mirus Bio ...