Labshake search
Citations for Addgene :
1951 - 2000 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... first pcDNA5 PURO FRT TO EGFP-AID-CENATAC was created by cloning CENATAC cDNA derived from HeLa cells into empty pcDNA5-FRT-TO-EGFP-AID (Addgene, 80075) using the cDNA PCR primers in Table S9 and digestion of both the PCR product and the plasmid with NotI/ApaI ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... approximately 500,000 cells in 6-well plates were transfected with 2000ng dCas9-KRAB-MeCP2-containing PiggyBac expression plasmids (Addgene plasmid #110821) and 400ng of transposase vector PB200PA-1 using PEI ...
-
bioRxiv - Biophysics 2020Quote: ... we generated U2OS cells stably expressing H2B fused to the HaloTag by transfection of the pBREBAC-H2BHalo plasmid (Addgene plasmid # 91564) using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Genetics 2021Quote: ... 2 ml (1.5× 106/ml) cells plated in a well of a 6-well dish were transfected with 300 ng of Act::Cas9 (Addgene #62209) and the respective gRNA and repair templates for the 25C6 (75 ng pU6-3-25C6-gRNA1 (DGRC Cat# 1547) ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1.5 million cells were resuspended in Mirus nucleofector solution and electroporated with 5 ug of px458 plasmid (Addgene plasmid #48138) containing a small guide RNA (see Table S1 for oligonucleotide information ...
-
bioRxiv - Cell Biology 2021Quote: ... Real time analysis of NFAT4-GFP nuclear translocation in response to 10 µM Cch stimulation was calculated using the equation: Quantification of ER Ca2+ store depletion and refilling was measured by transfecting parental and MCU-KO HEK293 cells with red R-CEPIA1er (Addgene: #58216) using Lipofectamine 24 hrs prior to imaging ...
-
bioRxiv - Molecular Biology 2020Quote: Generation of CRISPR knockout MEF and human cell lines were carried out as follows: Individual sgRNA (see Table S3 for sgRNA sequence) were cloned into LentiCRISPRv2 (Addgene #52961). To produce and package infectious lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRNA gene knockdown or gene overexpression lentiviral vectors were transfected into HEK 293FT cells together with a packaging plasmid (psPAX2; Addgene; #12260) and envelope plasmid (pMD2G ...
-
bioRxiv - Cell Biology 2020Quote: Viral particles for the generation of stable overexpressed cell lines were produced by co-transfection of pLEX_307 (a gift from David Root, Addgene plasmid # 41392) containing the target gene ...
-
bioRxiv - Cell Biology 2020Quote: HAP1 wt cells as well as single cell-derived clones were obtained from Haplogen Genomics or generated in-house by transient transfection with px459 (Addgene #48139) vectors carrying sgRNAs against the selected genes ...
-
bioRxiv - Immunology 2021Quote: ... A549ACE2 cells were generated using lentiviral transduction of a human ACE2 cDNA expressing plasmid (backbone: pLV-EF1a-IRES-Puro (Addgene 85132) as previously described [31] ...
-
bioRxiv - Immunology 2021Quote: ... produced in HEK293FT cells transiently transfected with two packaging plasmids (psPAX2 and pMD2-G) and the lentiCRISPR v2 plasmid (Addgene #52961)11 containing a non-targeting (GGCATCTTAACTAATCGTCT ...
-
bioRxiv - Cell Biology 2021Quote: ... Lig4-/-:53bp1-/- and Lig4-/-:53bp1-/- cell lines were made by transiently transfecting 53bp1 or Lin37 guide RNAs (gRNAs) in the pX330 vector (Addgene# 42230) into WT or Lig4-/- cells followed by subcloning by limited dilution ...
-
bioRxiv - Physiology 2021Quote: A549 cells (NCI-DTP Cat# A549, RRID:CVCL_0023) were identically transfected with GFP-eNOS (provided by W. Sessa, Addgene plasmid #22444; RRID:Addgene_22444) and/or mCherry-HSP90 (provided by D ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentivirus was produced by co-transfection of HEK293T cells with a lentiviral vector and the packaging plasmids psPAX2 (Addgene, plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag FKHR AAA mutant; gift from Kunliang Guan; Addgene plasmid # 13508) using polyethyleneimine ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Microbiology 2020Quote: ... A549-ACE2-Cas9 cells were generated by transduction of A549-ACE2 cell line with a packaged lentivirus expressing the mCherry derived from the lentiCas9-Blast (Addgene #52962) that the blasticidin resistance gene was replaced by mCherry ...
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 Tet on cells were generated by transduction of Huh-7 cells with lentivirus generated using the pCW57.1 plasmid (gift from David Root, Addgene plasmid # 41393).
-
bioRxiv - Immunology 2021Quote: ... LentiGuide-Puro empty vector (control) or SP140 gRNA cloned plasmids were then co-transfected into HEK293T cells with the packaging plasmids pVSVg (AddGene 8454) and psPAX2 (AddGene 12260 ...
-
bioRxiv - Cell Biology 2021Quote: ATM KO HMC3 cells were generated using a vector encoding SpCas9(D10A) nickase (kind gift of Feng Zhang; Addgene plasmid #48141) (65 ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 CRISPR/Cas9 edited cell lines were generated by first isolating clones with doxycycline-inducible expression of Cas9 (Addgene, 50661), then infected with lentivirus harboring the sgRNA and selected with 4 μg/ml blasticidin ...
-
bioRxiv - Cell Biology 2021Quote: ... To generate Ftractin-mCherry stable STIM1-10A and WT MEFs, cells were infected with lentivirus expressing Ftractin-mCherry (Hayer et al., 2016) (Addgene #85131). The plasmid pLenti-EB1-EGFP was obtained from Addgene (plasmid # 118084) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA-mediated knockdown of CCL5 and CXCL10 in the dMMR MC38 cells was achieved using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Stably knocked down cells were selected with 250 ug/ml hygromycin and knockdown was confirmed by Western blot.
-
bioRxiv - Microbiology 2020Quote: ... cDNA used to generate ACE2 positive cells was constructed as follows: the ACE2 PmeI cDNA fragment obtained from the plasmid hACE2 (Addgene; #1786) was cloned in pMD2iPuror opened in EcoRV.
-
bioRxiv - Synthetic Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Cell Biology 2022Quote: ... replication-deficient lentiviruses were produced and titrated as described by co-transfection of the resulting constructs in HEK-293T cells with the HIV-1 packaging plasmid psPAX2 (Addgene #12260) and the plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: NRK/TRIM21 cells stably expressing mCherry-TRIM21 were generated by transducing NRK cells with lentiviral particles that were produced by co-transfection of HEK293T cells with pSMPP- mCherry-hTRIM21 (a gift from Leo James, Addgene # 104972), psPAX and pVSVG using PEI Max (Polysciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... Polyethyleneimine was then used to co-transfect the cells with reporter plasmid [pCINeo-GFP (obtained from Christopher Buck, NIH) or pCAG-HcRed (Addgene #11152)] and p16sheLL expressing HPV16 L1 and wild-type or mutant L2 ...
-
bioRxiv - Microbiology 2022Quote: ... U-2 OS cells stably expressing the Bmal1 promoter in front of luciferase (Bmal1-luc) were generated using the pABpuro-BlucF plasmid (Addgene #46824) and maintained in 2 µg/ml puromycin (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviruses were produced by triple transfection of HEK-293T cells with the lentiviral transfer vector pLenti6.3/TO/V5-Blasti and the packaging plasmids psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Genome-wide CRISPR/Cas9 positive selection screens were performed as previously reported.51 KBM7 cells constitutively expressing Cas9 (KBM7-Cas9, 250 million) were transduced with the Brunello sgRNA library (Addgene #12260) at a multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded at 20% confluence and infected with lentivirus generated from pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang (41)) engineered to deliver Cas9 and a gRNA targeting LMAN1 (CCCCTTACACTATAGTGACG) ...
-
bioRxiv - Cancer Biology 2023Quote: ... as described previously.16,49 Sting knockdown in the MSI MC38 CRC cells was generated as described previously using shRNA and the pLKO.1 system.16,50 Ovalbumin (OVA) expressing MSI and CIN MC38 CRC cells were made by transfection with the pCI-neo-cOVA plasmid (Addgene #25097) and selection with 200 µg/ml G418.51
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were co-transfected with vectors the ORF3a proteins and the vector or 4xmts-Neon-Green (mitochondria; Addgene, #98876). At 48 h post-transfection ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in vivo confocal imaging was used in cells co-transfected with the FRET-based ER-ZapCY1 probe (Addgene, Catalog nr. 36321)[75] and ZnT9-50Met ...
-
bioRxiv - Genomics 2023Quote: ... 4M cells were plated in a 10cm dish for 24-hours before transfecting HEK293T cells with 9ug of dCas9-mCherry-KRAB (Addgene #60954), 4ug of packing plasmids psPAX.2 and 2ug of the envelope vector pMD2.G diluted in OptiMEM medium and Trans-Ltl transfection reagent (Mirus) ...
-
bioRxiv - Genomics 2023Quote: The A549-TetR-Cas9 cell line was created by simultaneously transfecting A549 cells with piggyBac transposase and a piggyBac cargo plasmid containing TetR-inducible Cas9 (Addgene #134247), and selecting for 7 days with 500 ug/mL G418 ...
-
bioRxiv - Neuroscience 2023Quote: ... For optogenetic activation of PRF/GlyT2+ cells we injected AAV5.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (based on Addgene plasmid #20298, UNC Vector Core) or for control AAV5.EF1a.DIO.eYFP.WPRE.hGH (based on Addgene plasmid #27056 ...
-
bioRxiv - Molecular Biology 2023Quote: 1.6 x 108 A375 cells were transduced into thirty-two 150 mm plates with lentivirus carrying The Toronto Knockout Library v3 (TKOv3, Addgene # 90294) in standard culture media + 8 µg/mL polybrene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Due to the Purmocyin resistance the XEN-dCas9-BFP-KRAB cells were infected with a modified version of the pLKO5.GRNA.EFS.PAC vector (Addgene, cat. no. 57825) replacing puromycin with blasticidin resistance ...
-
bioRxiv - Genomics 2023Quote: ... lentiviral particles encoding dCas9-BFP-KRAB were generated by transfecting HEK293T cells with plasmids encoding dCas9-BFP-KRAB (pHR-SFFV-dCas9-BFP-KRAB, Addgene 46911) and the ViraPower lentiviral packaging mix (ThermoScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... viruses were produced in HEK 293T cells by transfecting the corresponding plasmid o interest as well as with pVSVg (Addgene, #8454) and psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: STING1 KO HMC3 cells were generated using the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector kindly gifted by Feng Zhang (Addgene plasmid #62988)73 containing the following single guide RNA (sgRNA ...
-
bioRxiv - Systems Biology 2023Quote: The CRISPRi Calu-3 cell line was generated by lentiviral delivery of pMH0001 (UCOE-SFFV-dCas9-BFP-KRAB) (19) (Addgene #85969) into Calu-3 cells ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were co-transfected with equal amounts of this plasmid and pCas9_GFP32 (a gift from Kiran Musunuru, Addgene plasmid # 44719). GFP-positive cells were sorted after 48 hours on a MoFlo cell sorter (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dox-inducible GFP-HMGB1mut U2OS cells were generated using a previously described pPB-TetON-mEGFP-HMGB1-MUT PiggyBac transposon (Addgene #194562)39 ...
-
bioRxiv - Cell Biology 2023Quote: ... The following day, cells were co-transfected (using Lipofectamine 3000 treatment, as described above) with pMD2.g (envelope plasmid, Addgene #12259), psPAX2 (packaging plasmid ...