Labshake search
Citations for Addgene :
1951 - 2000 of 2527 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... hTERT-RPE1 Plk1 FRET Sensor cells were prepared by transfecting Plk1-FRET sensor c-jun substrate plasmid37 (Addgene: 45203) in hTERT-RPE1 cells using X-tremeGENE™ 9 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were produced in 293T cells by using psPAX2 and pCMV-VSV-G packaging plasmids (Addgene 12260, 8454). Viral supernatant was collected after 48h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviral particles were produced in 293T cells by transfecting pCG-gag-pol and pCMV-VSV-G packaging plasmids (Addgene) together with the corresponding retroviral plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: CRISPR mediated mutagenesis of target genes was performed by transducing K562 cells stably expressing Cas9 (lentiCas9-Blast, Addgene #52962) with lentivirus expressing sgRNAs (lentiGuide-Puro ...
-
bioRxiv - Neuroscience 2022Quote: ... N2a cells were co-transfected with the wild-type or FeRIC channels and GCaMP6 (GCaMP6 medium, Addgene cat.40754) or YFP-H148Q ...
-
bioRxiv - Microbiology 2024Quote: ... pseudovirus constructs (PV) have been developed by three-plasmid co-transfection in HEK293 cells using lentiviral backbone (Addgene # 8455), firefly luciferase reporter (Addgene #170674 ...
-
bioRxiv - Immunology 2024Quote: Pseudo-lentiviral particles containing sCD177 construct were generated using 293T cells and packaging vectors pMD2.G and pCMV-dR8.74psPAX2 (Addgene). Pseudo-lentiviral particles were transduced into the FreeStyle 293-F cells (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses containing shRNA or sgRNA were produced using 293FT cells with packaging constructs pCMV-VSVG and pCMV-Delta 8.2 (Addgene). The lentiviruses were collected 48 hrs post transfection and concentrated by ultracentrifugation at 25,000 rpm for 2 hrs ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Bioengineering 2022Quote: ... Lentivirus was produced using calcium phosphate co-transfection of HEK293T cells with the psPAx2 plasmid (packaging vector, Addgene #12260), pMd2g plasmid (VSVG envelope ...
-
bioRxiv - Cell Biology 2024Quote: ... enables GFP and APEX to be targeted to cilia in many cell types via the N-terminal 203 residues of NPHP3 and was a gift from Maxence Nachury (RRID:Addgene_73186) (Mick et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected with the Lenti-iCas9-neo vector (Addgene plasmid #85400, a gift from Qin Yan) (Cao et al ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Parental HEK293 cells were co-transfected with 1.0 µg each of PBKS-Cas9-2A-eGFP plasmid (Addgene plasmid #68371) and plasmid encoding for gRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lenti-U6BC-sgDbl/Cre vectors were transfected as a pool into 293T cells with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Microbiology 2023Quote: ... Lentiviral packaging was carried out in HEK293T cells using the 3rd generation packaging plasmids pCMV delat R8.2 (#12263; Addgene) and pCMV-VSVG (#8454 ...
-
bioRxiv - Developmental Biology 2023Quote: ... viral lenti-particles were generated by transfecting HEK293 cells in a T25 flask with 15 μg of the lentiviral WβS-reporter vector (7TGC; Addgene #24304 ...
-
bioRxiv - Biochemistry 2023Quote: ... cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene 12259), pRSV-Rev (Addgene plasmid #12253 ...
-
bioRxiv - Cell Biology 2023Quote: ... Gene knockdown was performed in a sub-clonal K562 cell line stably expressing dCas9-KRAB-BFP (Addgene plasmid #102244), generously provided by Eric J ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transiently transfected with Cas9 and single guide RNAs plasmids with EGFP expression (PX458; Addgene plasmid no. 48138). The single guide RNAs targeting CDK6 and CDK4 (sequences TTAGATCGCGATGCACTACT and ATCTCGGTGAACGATGCAAT respectively ...
-
bioRxiv - Cell Biology 2023Quote: Whole-genome CRISPR screens were performed in U2OS and U2OSp53KO cells using the GeCKOv2 two-vector system (Addgene, #1000000049). The two pooled DNA half-libraries (A and B ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentiviral vectors were co-transfected into 293T cells with the packaging vectors pCMV-dR8.2 dvpr and pCMV-VSV-G (Addgene). Virus-infected cells were selected with 2 μg/ml puromycin ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Genomics 2023Quote: ... Cells were transfected with each DNMT3B or GFP-only construct in addition to pCMV-dR8.2 dvpr (Addgene, plasmid #8455) and pCMV VSV-G (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... Retrovirus were produced by transfecting HEK 293T cells with a mixture of PD-L1-pMIT1.1 (or PD-L2-pMIT1.1) and pCL-Eco (Addgene #12371) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable sgCTRL and sgHORMAD1 cell lines were generated using pLX-sgRNA and pCW-Cas9 constructs (Addgene plasmid #50662, #50661) as described previously (Nichols et al. ...
-
bioRxiv - Microbiology 2023Quote: ... while long-term single-gene knockout cell lines were generated using sgRNAs in pLenti SpBsmBI sgRNA Hygro (Addgene, 62205) containing a hygromycin resistance cassette ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral particles were produced in HEK293T cells using psPax2 and pMD2.g second-generation packaging plasmids (Addgene #12260, #12259) with jetPRIME Polyplus transfection reagent ...
-
bioRxiv - Cancer Biology 2023Quote: Derivatives of KP and KPK cells were generated by stable lentiviral transduction of Cas9 with blasticidin resistance (Addgene#52962). Cells were maintained with blasticidin selection throughout the experiment ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK-293T cells were transfected with the respective genome library along with helper plasmids pCAG-B19N (Addgene cat. # 59924), pCAG-B19P (Addgene cat ...
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced from transfected HEK293T cells with packaging vectors (pMD2.G #12259, Addgene, and pCMV-dR8.91, Trono Lab) following the manufacturers protocol (#MIR6605 ...
-
bioRxiv - Microbiology 2023Quote: ... hGM-CSF and hIL-4 were produced from HEK293 cells stably transduced with pAIP-hGMCSF-co (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
bioRxiv - Microbiology 2023Quote: N4BP1 KO Huh7 cells were generated by CRISPR/Cas9 using pX330-U6-Chimeric_BB-CBh-hSpCas9 (pX330, Addgene, MA, USA) and HR110PA-1 (System Biosciences ...
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... PLD3 KO cell line was generated from HEK293BlueTM hTLR9 by transfecting 2 μg hSpCas9-sgRNA expressing plasmid (Addgene #99154) cloned with gRNA sequence 5′-guccucauucuggcgguugu-3′ ...
-
bioRxiv - Biochemistry 2023Quote: Luciferase reporter assays were performed in MEF cells transfected with a UCP3 reporter plasmid[18] (UCP3 EP1, Addgene #71743) or PGC-1α 2kb promoter (Handschin et al ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids used for CRISPR KO cells lines lentiCRISPR v2 and lentiCRISPR v2-Blast were originally from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were transfected for 6 hours with 80 ng 3xERRE-ERE-luciferase containing codon-modified firefly luciferase (Addgene #37852) and 16 ng pRL-SV40P (Addgene #27163 ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells at 80% confluence were transfected with a mix of 1.8 μg gag/pol packaging plasmid (Addgene #14887), 0.7 μg pRev packaging plasmid (Addgene #12253) ...
-
bioRxiv - Developmental Biology 2024Quote: ... a clone of EUC313f02 NipblFLEX/+ ES cells (European Conditional Mouse Mutagenesis Program) was transfected with pCAG-Cre:GFP (Addgene #13776) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa Cas9 cells were generated with the lentiCas9-Blast plasmid 87 (Addgene plasmid #52962; http://n2t.net/addgene:52962; RRID: Addgene_52962), a gift from Feng Zhang ...
-
bioRxiv - Biochemistry 2024Quote: ... isoform 1) was amplified from K562 cDNA and inserted into insect cell expression vector 438-B (Addgene plasmid: 55219) (N-terminal 6x His (His6 ...
-
bioRxiv - Microbiology 2024Quote: Lentivirus was produced in HEK-293T/17 cells by co-transfection of lentiviral plasmids with psPAX2 (Cat# 12259, Addgene) and pMD2.G (Cat# 12259 ...
-
Direct and indirect regulation of β-glucocerebrosidase by the transcription factors USF2 and ONECUT2bioRxiv - Molecular Biology 2024Quote: LN-229 cells were co-transfected with the plasmid encoding the sgRNAs as outlined below and hCas9 (Addgene #41815) using Lipofectamine 3000 in a ratio of 3:1 ...
-
bioRxiv - Molecular Biology 2024Quote: HCT116 cells (eIF6-WT and eIF6-N106S) were transfected with 4µg of pcDNA-firefly-luciferase plasmid DNA (Addgene; 18964) and 20 µL of Lipofectamine 2000 (Invitrogen) ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... MDA-LM2 and HCC1806-LM2 cells expressing dCas9-KRAB fusion protein were constructed by lentiviral delivery of pMH0006 (Addgene #135448) and FACS isolation of BFP-positive cells.
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transduced the next day with 1000 ng of plasmid DNA plus 250 ng pMD2.G (Cat# 12259, Addgene) and 750 ng psPax2 (Cat# 12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... SPRY2 CRISPR oligonucleotides used in A549 cells (gRNA target site: CGTACTGCTCCGCGACCCTG) were cloned into lentiCRISPR v2 plasmid (Addgene pasmid #52961). DUSP6 CRISPR oligonucleotides used in H1299 cells were cloned into lentiCRISPR v2 plasmid (gRNA target site ...
-
bioRxiv - Immunology 2021Quote: ... Lentiviral particles were produced in 293T cells using pMD2.G and psPAX2 (from Didier Trono, Addgene plasmids #12259 and #12260), and pINDUCER-21 plasmids ...
-
bioRxiv - Genetics 2021Quote: ... We introduced this into cells by transfection of 129/B6 XY ESC together with the spCas9 plasmid pX459 (Addgene #62988), carrying a single gRNA sequence complementary for the p53 3’-end ...