Labshake search
Citations for Addgene :
2001 - 2050 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... To generate DOX inducible METTL3-KD cells in ALT+ NB METTL3- sh1 sequences were cloned in the Tet-pLKO-puro vector (21915, Addgene). As a control for inducible shRNA KD ...
-
bioRxiv - Biochemistry 2022Quote: ... the induced cells were made electrocompetent and subsequently co-transformed with pBEL2108 (a derivative of payload plasmid pKM468 (Addgene #108434)37 containing a 3C protease cleavage site upstream of the eGFP tag ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were generated by transfection of HEK 293 cells (Cat.# ACC635; DSMZ, Braunschweig, Germany) with Pmd2 (AddGene, Plasmid #12259), lentiviral envelope plasmid psPAX2 (AddGene ...
-
bioRxiv - Cancer Biology 2023Quote: The murine ID8-gTRP53-gBRCA1-Cas9 cell line was generated by co-transfecting a lentiviral Cas9-Blast vector (Addgene #52962) with the packaging plasmids pCMV-dR8.91 and pCMV-VSV-G (Addgene #8454 ...
-
bioRxiv - Systems Biology 2022Quote: ... Lentivirus expressing GFP was produced by co-transfection of HEK293ft cells with the following plasmids: plenti-CMV-Puro-DEST (Addgene #17452 ...
-
bioRxiv - Biochemistry 2023Quote: Mass spectrometry sample preparation: N2A cells were transfected with pcDNA3 plasmids containing 2X myc-EXOSC3 or pcDNA3 empty vector (Addgene) using Lipofectamine® 2000 (Thermofisher ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral particles were produced in HEK293T cells by transfecting a 10 cm plate with 15 µg packaging plasmid psPAX2(Addgene), 5 µg envelope plasmid pMD2.G (Addgene) ...
-
bioRxiv - Cancer Biology 2023Quote: ... GCB-DLBCL and MCL cell lines were co-transduced with lentivirus produced from TRE-KRAB-dCas9-IRES-GFP (Addgene #85556) and EF1a_TetOn3G (Clontech ...
-
bioRxiv - Cell Biology 2023Quote: ... In vitro target specific gRNA cleavage activity was validated by transfecting N2A cells with PCR amplified gRNA gblock and Cas9 plasmid DNA (px330, Addgene) using ROCHE Xtremegene HP ...
-
bioRxiv - Cell Biology 2023Quote: ... Tetracycline-on (Tet-on) cells were generated by lentiviral transduction with a pCW57.1 vector (Addgene plasmid 41393, David Root lab) containing a single-vector Tet-on component and were cultured in the presence of 1 µg/ml doxycycline (Clontech ...
-
bioRxiv - Molecular Biology 2024Quote: The 2C::tdTomato reporter cell line was generated by transfection of EB3 mESCs (catalog no. AES0139, RIKEN BRC Cell Bank) with a linearized 2C::tdTomato reporter plasmid (catalog no. 40281, Addgene). After 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... the plasmid to be packaged was co-transfected into HEK293T cells with a rep/cap containing plasmid pUCmini-iCAP-PHP.eB (Addgene #103005) and the helper plasmid pAdDeltaF6 (Addgene #112867) ...
-
bioRxiv - Microbiology 2023Quote: ... in 293-LTV cells transfected using jetPRIME (Polypus 101000027) with plasmids pCMV-VSV-G (a gift from Bob Weinberg Addgene plasmid # 8454 ...
-
bioRxiv - Bioengineering 2023Quote: Reporter cell lines for Cas9 and base editors were generated using lentiviruses made from CRISPR-SP-Cas9 reporter (Addgene #62733), pLV-SI-121 (Addgene #131126 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Breast cells were transduced at a high multiplicity of infection (MOI) with either Cas13d or CRISPRa (dCas9-VP64; Addgene #61425) lentivirus by spinoculation at 2,500 rpm for 1.5h at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Cell Biology 2023Quote: ... Non-GFP expressing ZT cells were obtained by sorting out non-fluorescence ZT cells and they were subsequently immortalized by transfecting them with SV40 T-antigen expressing plasmid (Addgene).
-
bioRxiv - Cell Biology 2023Quote: HEK293T-LentiX cells were co-transfected for 12 h with 10 µg psPAX2 (kind gift from Didier Trono, Addgene #12260), 2.5 µg pMD2.G (kind gift from Didier Trono ...
-
bioRxiv - Molecular Biology 2023Quote: Vero E6-TMPRSS2 cells were generated by transduction with a 2nd generation lentiviral vector pLEX307-TMPRSS2-blast (Addgene plasmid #158458) and selected for two weeks in DMEM containing 20 µg/mL of Blasticidin (Cat# SBR00022 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were co-transfected with two gRNAs and pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Addgene, 62987 (Ran et al., 2013)) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074 ...
-
bioRxiv - Cell Biology 2023Quote: Replication-deficient lentiviral particles were produced by CaCl2-transfection of 293-T cells with the packaging vector psPAX2 (Addgene, #12260), the envelope vector pMD2.G (Addgene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Yeast cells were transformed following a modified lithium acetate transformation protocol 157 with a pCAS-NAT or pCAS-HPH plasmid (Addgene plasmid 6084747 modified by 159 and 160 using the same approach as in 161 ...
-
bioRxiv - Immunology 2023Quote: Retrovirus were packaged by co-transfection of Phoenix-Eco cells with indicated plasmid and helper plasmid pCL-Eco (Addgene #12371) using calcium phosphate precipitate mediated transfection ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... HEK293T cells were co-transfected with pLenti-CRISPRv2 plasmids and the packaging plasmids pPAX2 (Addgene #12260, deposited by Didier Trono) and pMD2.G (Addgene #12559 ...
-
bioRxiv - Molecular Biology 2024Quote: Lentiviruses were produced in HEK293FT cells cultured in T225 flasks by cotransfection of 30μg of packaging plasmid (psPAX2, Addgene #12260), 30 μg of envelope plasmid (VSV-G ...
-
bioRxiv - Microbiology 2024Quote: ... Lentivirus were produced by transfection of 293T cells with pCMV-VSV-G (a gift from Bob Weinberg, Addgene plasmid #8454), psPAX2 (a gift from Didier Trono ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral vector lentiCRISPRv2 carrying both Cas9 enzyme and a gRNA transfected into HEK293T cells together with the packaging plasmids psPAX2 and pCMV-VSV-G (Addgene) at the ratio of 5:3:2 ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were co-transfected with a single gRNA and pCAS9-mCherry empty (Addgene, 80975 (Schmid-Burgk et al., 2016)) using TransIT-2020 (Mirus ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with a mixture of pSpCas9(BB)-2A-GFP plasmids (gift from Feng Zhang; Addgene plasmid #48138) containing two different sgRNA sequences (TTGGATGACTCGGACTCGCT and CGCTTGGTGATTCCATGTAA ...
-
bioRxiv - Genetics 2024Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
-
bioRxiv - Genomics 2024Quote: ... Lentivirus was produced in HEK293T cells co-expressing the shRNA plasmid together with psPAX2 packaging plasmid and pVSV-G envelope plasmid (Addgene). Virus was concentrated using Lenti-X Concentrator (Takara ...
-
bioRxiv - Genetics 2023Quote: ... 1 × 106 iPS cells were seeded at a density of 100,000 cells/cm2 and transfected with 3 μg pC13N-dCas9-BFP-KRAB (Addgene, 127968), 0.375 μg pZT-C13-L1 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... coli MG-1655 cells harboring the pEB1-mGFPmut2 plasmid where used throughout the study (pEB1-mGFPmut2 was a gift from Philippe Cluzel, Addgene plasmid #103980 ...
-
bioRxiv - Microbiology 2024Quote: ... 10cm cell culture grade petri dishes of approximately 80% confluent 293T cells were transfected with 1.4μg pMD2.G (VSV-G envelope expressing plasmid, a gift from Didier Trono (Addgene plasmid #12259), 3.6μg psPAX2 (Gag-Pol expression construct ...
-
bioRxiv - Cancer Biology 2021Quote: ... MOLM-13/Cas9+ cell line stably expressing luciferase was established via lentiviral infection with a Lenti-luciferase-P2A-Neo (Addgene # 105621) vector followed by G418 (1 mg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: HEK293T cells were transfected with plasmids encoding for Flag-p105 or Flag-p27 together with the plasmid HA-Ubiquitin (Addgene #18712). After 24h ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... The hTERT-RPE1 GFP-LC3-RFP reporter cell line was generated by transducing hTERT-RPE1(Cas9) cells with retroviral particles generated with the transfer plasmid pMRX-IP-GFP-LC3-RFP (Addgene: 84573). Single cell clones were isolated and reporter functionality was tested by Torin1 and Bafilomycin A1 treatments.
-
bioRxiv - Genetics 2021Quote: Lentivirus was produced by transfecting 293T cells with the gRNA and KRAB-dCas9 expression plasmid together with the packaging plasmids VsVg (Addgene 12259) and psPax2 (Addgene 12260 ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...
-
bioRxiv - Biophysics 2022Quote: ... Lentivirus expressing LifeAct-GFP were produced in HEK 293T cells by cotransfecting the lentiviral plasmids pLenti.PGK.LifeAct-GFP.W (a gift from Rusty Lansford, Addgene plasmid #51010; Watertown, MA) with psPAX2 and pMD2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 million cells per replicate were activated and 12-20 h later electroporated with the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene 48138) expressing the Myc sgRNA using the MaxCyte STx transfection system (MaxCyte) ...
-
bioRxiv - Cell Biology 2022Quote: Lentivirus particles were generated from HEK293T cells (ATCC CRL-3216) by co-transfection of lentiviral vectors with the packaging plasmid psPAX2 (Addgene #12260) and envelope plasmid pMD2G (Addgene #12259 ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... and Linearized pShuttle-CMV plasmids were transformed into the final viral backbone using electrocompetent AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399). Successful incorporation of pShuttle-CMV construct into AdEasier-1 cells confirmed via digestion with PacI (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: Lentiviral particles to generate CRISPR/Cas9-edited cell lines were produced by transfecting 10 cm dishes of HEK293T cells with 1.5 μg of pLentiCRISPRv2 encoding gene specific guide RNAs (Addgene plasmid #52961), 1 μg of p8.91 packaging plasmid(Zufferey et al. ...
-
bioRxiv - Genomics 2020Quote: ... Separately infected cells were counted and pooled after selection with puromycin and KRAB-dCas9 (TRE-KRAB-dCas9-IRES-BFP, Addgene 85449) was induced with 1 μg/ml doxycycline (Millipore Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: OsTIR1 was integrated into AAVS1 locus of the HEK293T cells using the CMV-OsTIR1-PURO plasmid from Masato Kanemaki (pMK232, Addgene #72834) (Natsume et al ...
-
bioRxiv - Genetics 2019Quote: ... CRISPRi-FlowFISH and qPCR experiments used K562 cells expressing KRAB-dCas9-IRES-BFP from a third generation tet-inducible promoter (Addgene # 85449).