Labshake search
Citations for Addgene :
1751 - 1800 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... cells were transfected with either (G4C2)92 and (G4C2)2 lentiviral transfer plasmids along with PAX (Addgene #12260) and VSV-G (Addgene #12259 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HEK-293 cells were transfected with two plasmid vectors CMV–R-GECO1 (a gift from Robert Campbell, Addgene plasmid #32444 ...
-
bioRxiv - Microbiology 2024Quote: ... N/Tert-1 Cas9 knockout cells were generated by transduction with a spCas9 lentiviral expression vector (Addgene # 52962) and selecting with blasticidin ...
-
bioRxiv - Molecular Biology 2024Quote: ... the HEK293T cells were transfected with the respective constructs along with envelope plasmid (pMD2.G) (Addgene, Cat# 12259), and packaging plasmid (psPAX2 ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were reprogrammed by a mixture of retroviral vectors encoding OCT3/4 (pMXs-hOCT3/4 Addgene: 17217), SOX2 (pMXs-hSOX2 Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... MutuI cells were transduced with lentiparticles derived from the doxycycline inducible Cas9 vector pCW-Cas9 (Addgene Plasmid #50661) and selected for stable integration with 2 μg/mL puromycin ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with CYRI-B-p17-GFP and mCherry-β1 integrin (Addgene plasmid #55064) and plated on laminin coated glass bottom dishes ...
-
bioRxiv - Cancer Biology 2023Quote: Retroviral supernatants were prepared by co-transfecting 293T cells (DSMZ, cat ACC635) using pCL ECO (Addgene, cat 12371) for mouse cells or pCL ampho for human cells and a retroviral vector ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were immortalized by transduction with a retrovirus expressing SV40 large T antigen from pBABE-puro largeTcDNA (Addgene plasmid # 14088 ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-42:AAVS1-mTagRFPT-CAAX was a gift from Allen Institute for Cell Science (Addgene plasmid # 107580; http://n2t.net/addgene:107580; RRID:Addgene_107580). APEX2-NLS ...
-
bioRxiv - Genetics 2023Quote: ... The HAP1 cells used in SMuRF were immortalized using lentivirus packaged with pLV-hTERT-IRES-hygro (Addgene, 85140), a gift from Tobias Meyer ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-82:SON-mEGFP was a gift from Allen Institute for Cell Science (Addgene plasmid # 133964; http://n2t.net/addgene:133964; RRID:Addgene_133964). AICSDP-42:AAVS1-mTagRFPT-CAAX was a gift from Allen Institute for Cell Science (Addgene plasmid # 107580 ...
-
bioRxiv - Cell Biology 2023Quote: ... we measured intramitochondrial free Ca2+ levels by transfecting AML12 cells with the CMV-mito-GEM-GECO1 plasmid (Addgene, 32461 ...
-
bioRxiv - Cancer Biology 2021Quote: SPRY2 CRISPR oligonucleotides used in H1299 cells (gRNA target site: GTACTCATTGGTGTTTCGGA) were cloned into pSpCas9(BB)-2A-Puro (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2020Quote: ... a cell line stably expressing Cas9 was generated by infection with lentiCas9-Blast (Addgene 52962, gift from Feng Zhang) and selection with blasticidin ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg pSMPUW-IRIS-Neo-H2BmRFP (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... ACE2-expressing lentivectors were generated via transient co-transfection of HEK293T cells with RRL.sin.cPPT.SFFV/Ace2.IRES-puro (Addgene Plasmid #145839), psPAX2 and VSV-G ...
-
bioRxiv - Molecular Biology 2020Quote: ... this line (148.4) was derived from E14 mouse ES cells and is homozygous for a Tir1-2A-Puro cassette (Addgene plasmid # 92142 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected with the addressing and packaging plasmids (pCMV delta R8.2, Addgene #12263; pCMV-VSV-G, Addgene #8454). After 48 hours of expression ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transfected with the addressing and packaging plasmids (pCMV delta R8.2, Addgene #12263; pCMV-VSV-G, Addgene #8454). After 48 hours of expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...
-
bioRxiv - Molecular Biology 2021Quote: ... The IRE-SunTag reporter was integrated in previously established HeLa cell line stably expressing scFv-GFP (Addgene plasmid: 104998) and NLS-stdMCP-stdHalo fusion protein (Addgene plasmid ...
-
bioRxiv - Genomics 2020Quote: ... Mutagenesis was performed via either an inducible Cas9-expressing OCI-AML3 cell line (Lenti-iCas9-neo vector; Addgene 85400) with lentiviral sgRNA expression (Addgene 70683) ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T/17 cells were cotransfected with the respective transfer vector and second-generation lentiviral cassettes (packaging vector psPAX2 (Addgene RRID:Addgene_12260) and envelope vector pMD2.G (Addgene RRID:Addgene_12259) ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentivirus carrying CRISPR-Cas9 constructs were produced using HEK293 cells with the following plasmids: pSS172 (pMD2.G, Addgene #12259), pSS173 (psPAX2 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... we co-transfected cells with a plasmid for GCaMP6s under a ubiquitous promoter for Ca2+-imaging (Addgene, plasmid #40753) and a plasmid encoding for the mGlu5 receptor lacking eYFP16 to avoid bleed-through into the Ca2+-reporter channel.
-
bioRxiv - Biochemistry 2019Quote: ... 4T1 and E0771 cGAS−/− cells were created by viral transfection of CRISPR sgRNA (using lentiCRISPRv2-blast, Addgene plasmid #83480) targeting mouse Mb21d1 (5’-CACCGGAAGGGGCGCGCGCTCCACC-3’) ...
-
bioRxiv - Biophysics 2019Quote: ... virus was produced in HEK 293T cells by co-transfecting the lentiviral plasmids pLenti.PGK.LifeAct-Ruby.W (a gift from Rusty Lansford - Addgene plasmid #51009) with psPAX2 and pMD2.G (a gift from Didier Trono - Addgene plasmid #12260 and #12259) ...
-
bioRxiv - Microbiology 2020Quote: The mouse cDNA sequence of filamin A from MEF cells was amplified and cloned into pcDNA3-myc plasmid (Addgene). The resulting plasmid pcDNA3- myc-FLNA was transiently transfected in the MEF cells and then the transfected cells were infected with Toxoplasma for 18 h (MOI ...
-
bioRxiv - Cancer Biology 2019Quote: ... K562 cells (ATCC CCL-243) were first transduced with lentiviral particles produced using vector pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP (Addgene #60903 ...
-
bioRxiv - Cell Biology 2020Quote: ... 400,000 cells were transiently co-transfected with 200 ng of each gRNA expression plasmid (cloned into Addgene plasmid #43860), 500 ng Cas9 expression plasmid (Addgene plasmid #43945) ...
-
bioRxiv - Molecular Biology 2021Quote: ... stable Cas9 expression was induced by transducing FL83B cells with lentiCas9-Blast (Addgene, #52962-LV, gift from Feng Zhang) lentivirus at a multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2021Quote: ... used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434; http://n2t.net/addgene:26434; RRID: Addgene_26434 ...
-
bioRxiv - Cell Biology 2021Quote: ARPE-19 cells were transduced with the lentiviral vector pCW-Cas9 (a gift from Eric Lander & David Sabatini, Addgene plasmid # 50661 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were transfected using Lipofectamine 2000 with plasmids encoding pEGFP-C2 SENP2 (gift from Mary Dasso, Addgene plasmid # 13382) and infected 24 h later ...
-
bioRxiv - Microbiology 2020Quote: All virus-like particles were generated in HEK293T cells via calcium phosphate transfection using packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293T cells were transfected with packaging plasmid psPAX2 and envelope plasmid pMD2.G (both gifts from Didier Trono, Addgene plasmid # 12260 ...
-
bioRxiv - Cancer Biology 2020Quote: MOLM-13-Cas9 cells were first transduced with a luciferase expressing cassette in Lenti-luciferase-P2A-Neo (Addgene #105621) vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 293 cells were seeded in 10-cm-diameter dishes and transfected with pCMV-dR8.2 dvpr (Addgene plasmid #8455), pCMV-VSV-G (Addgene plasmid #8454 ...
-
bioRxiv - Biophysics 2022Quote: Escherichia coli NiCo21 (DE3) competent cells were transformed with the plasmid encoding sumo-tag fused DiCas7-11 (Addgene: 172503). A single colony was picked and transferred to 100mL LB media containing 50 μg/mL ampicillin and grown for 12 hours at 37°C before inoculation into 1L LB culture ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were seeded in 96-well plates and transfected 24h after with pMXs GFP-LC3-RFP (#117413, Addgene, MA) or with Polyinosinic-polycytidylic acid sodium salt ...
-
bioRxiv - Immunology 2022Quote: ... cells were transfected with 1.0 μg of pLV-PTB or pLV-CTRL with 0.8 μg psPAX2 (Addgene plasmid 12260) and 0.2 μg of pCI-VSVG (Addgene plasmid 1733 ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293T cells (Dharmacon) were transfected with the Ass1 targeting lentiCRISPRv2 vectors and the lentiviral packing plasmids psPAX2 (Addgene: #12260) and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... T98GEmpty and T98GcGAS cell lines were stably transfected with sfGFP-N1 (gift from Michael Davidson & Geoffrey Waldo; Addgene #54737) using phosphate calcium ...
-
bioRxiv - Cancer Biology 2022Quote: ... The PDE6D scan library contains 116 unique sgRNA was packaged by HEK293 cells (ATCC) co-transfected with psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: HEK293 T-REx SNAPf-GLP-1R cells were co-transfected with an AP2-HA plasmid (μ2-HA-WT; Addgene plasmid # 32752 ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells were transfected with the relevant vectors and the second-generation packaging plasmids ΔR8.2 and Vsv-G (Addgene). Virus-containing supernatants were collected 48 h later and added with Polybrene to AML cells pre-seeded at ∼5 × 105/well in 24-well plates (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... These pLKO.1 constructions were transfected in the 293T packaging cell line along with pMD2.G and pCMV-dR8.91 vectors (Addgene), following a typical Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... A549-ACE2-TMPRSS2 and Huh7-TMPRSS2 stable cell lines were generated using commercial lentivirus (Addgene, catalog no. 154982-LV) and selected using 10 μg/ml blasticidin (InvivoGen ...