Labshake search
Citations for Addgene :
2151 - 2200 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... lentiviral particles encoding dCas9-BFP-KRAB were generated by transfecting HEK293T cells with plasmids encoding dCas9-BFP-KRAB (pHR-SFFV-dCas9-BFP-KRAB, Addgene 46911) and the ViraPower lentiviral packaging mix (ThermoScientific) ...
-
bioRxiv - Immunology 2023Quote: ... 293T cells were co-transfected with equal amounts of this plasmid and pCas9_GFP32 (a gift from Kiran Musunuru, Addgene plasmid # 44719). GFP-positive cells were sorted after 48 hours on a MoFlo cell sorter (Beckman Coulter) ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral particles were prepared in HEK293T cells using standard calcium-phosphate transfection of the lentivector with packaging plasmids pMD2.G (Trono lab, Addgene #12259) and pCMV-dR8.74 (Trono lab ...
-
bioRxiv - Cell Biology 2023Quote: ... The vector V2 CRISPR DNA Plasmid (1ug) was co-transfected in 293T cells along with 3 µg of the viral envelope PMD2 (Addgene # 12259) and 4 µg of the viral packing PsPAX (Addgene #12260 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Initiative for Genome Editing and Neurodegeneration core in the Department of Cell Biology at Harvard Medical School) or cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) and transfected into HEK293FT using Lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Genetics 2023Quote: ... Cells were co-transfected with Cas9-gRNA RNP complex together with the repair oligo and Puromyin-GFP plasmid39 (Addgene, Watertown, MA) using Lipofectamine Stem transfection reagent (ThermoFisher ...
-
bioRxiv - Physiology 2023Quote: ... Tracking of the plus-end side of the microtubules was performed by transiently transfecting the cells with EB3-tdTomato (Addgene #50708) 24 hours after plating following the protocol described in the previous section ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles pseudotyped with the VSV-G protein were produced by cotransfecting HEK293T cells in 10cm dishes with 5 mg pLentiCMVPuroDEST vector (Addgene, #17452), 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259 ...
-
bioRxiv - Microbiology 2023Quote: HPV16 PsVs were produced by co-transfecting 293TT cells with wild-type p16SheLL-3XFLAG tag [14] together with pCAG-HcRed (Addgene #11152) or pCINeo-GFP [obtained from C ...
-
bioRxiv - Genomics 2023Quote: K562 cells expressing dCas9-VP64 were generated in-house via lentiviral integration of a dCas9-VP64-blast construct7 (Addgene Plasmid #61422) into K562 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... each cell line was given fresh growth medium and transfected with a plasmid mixture containing 1μg PB-rtTA (Addgene #126034; 22) and 1μg pUC19-piggyBac transposase 23 using Lipofectamine 3000 (Thermo Fisher L3000001) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Virus was produced in HEK293T cells (ATCC CRL-3216) by calcium phosphate co-transfection of lentiviral shuttle and packaging vectors (pRRE (Addgene #12251), pRev (Addgene #12253) ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2023Quote: ... as described previously.16,49 Sting knockdown in the MSI MC38 CRC cells was generated as described previously using shRNA and the pLKO.1 system.16,50 Ovalbumin (OVA) expressing MSI and CIN MC38 CRC cells were made by transfection with the pCI-neo-cOVA plasmid (Addgene #25097) and selection with 200 µg/ml G418.51
-
bioRxiv - Cancer Biology 2023Quote: ... we used HEK293T cells co-transfected with lentiviral constructs encoding the target sgRNAs and second-generation packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... RAW264.7-TLR2-KO cells were generated by CRISPR-Cas9 using the LentiCRISPR-v2 system (kind gift from Dr. Brett Stringer, Addgene#98290) targeting an early PAM site in the Tlr2 coding exon ...
-
bioRxiv - Cancer Biology 2023Quote: Engineering of Luc-tagged HCC1954 cells (HCC1954-Luc) and tumour implantation: the pLenti CMV Puro LUC (w168-1) was purchased from Addgene (#17477) and used in all in vivo experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... integrating lentivirus for both Cas9 and sgRNA was generated by overnight transfection of adherent HEK293 cells with either the Cas9 or sgRNA vector and the packaging vectors psPax (Addgene #1226) and pMD2g (Addgene #12259) ...
-
bioRxiv - Neuroscience 2023Quote: ... An additional round of CRISPR/Cas9 genome editing was performed on one clonal cell line to further disrupt the coding region of endogenous Scn9a using recombinant pX458 plasmid (pSpCas9-2A-GFP; Addgene #48138) and a gRNA targeting the in-frame deletion (Scn9a ...
-
bioRxiv - Neuroscience 2023Quote: ... Neuro2a cells stably expressing the CVS-N2c glycoprotein (N2A-N2cG_02 cells) were transfected with the barcoded N2c library along with helper plasmids pCAG-N2cN (Addgene cat. # 100801), pCAG N2cP (Addgene cat ...
-
bioRxiv - Immunology 2023Quote: ... Lentiviral vector pLenti-CMV-Puro-DEST containing EGFP-rNLRP1-MYC was transfected into Lenti-X cells together with packaging plasmid psPAX2 (Addgene #12260) and Lentiviral envelope plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Immunology 2023Quote: Retrovirus were packaged by co-transfection of Phoenix-Eco cells with indicated plasmid and helper plasmid pCL-Eco (Addgene, Cat# 12371) using calcium phosphate precipitate mediated transfection ...
-
bioRxiv - Microbiology 2023Quote: ... The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The primer sequences used in amplifying human and mouse CUL1 and UBE2L3 coding sequences are listed in Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The functionality of T7 polymerase and VSVG expression in 293FT-T7pol-VSVG cell lines was determined using pUC19-T7pro-IRES-EGFP (Addgene, 138586) or through the recovery of rVSV virus.
-
bioRxiv - Genomics 2023Quote: ... Lentivirus containing the landing pad sequence was produced by co-transfecting 293T cells at ∼50% confluence with psVSV-G (Addgene #12259), psPAX2 (Addgene #12260) ...
-
bioRxiv - Cell Biology 2023Quote: Cas9-expressing Ctgf-P2A-GFP C2C12 cells were infected with validated lentiviral particles generated from a whole-genome CRISPR-Brie library (Addgene, #73632). After 24 hours ...
-
bioRxiv - Cell Biology 2023Quote: U2OS T-REx FLAG-HA-FAM134s stable and inducible cell lines were infected with lentivirus carrying the pCW57-CMV-ssRFP-GFP-KDEL (Addgene #128257). We previously deleted the tetracycline response element ...
-
bioRxiv - Cell Biology 2023Quote: ... The following day, cells were co-transfected (using Lipofectamine 3000 treatment, as described above) with pMD2.g (envelope plasmid, Addgene #12259), psPAX2 (packaging plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were co-transfected with vectors the ORF3a proteins and the vector or 4xmts-Neon-Green (mitochondria; Addgene, #98876). At 48 h post-transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dox-inducible GFP-HMGB1mut U2OS cells were generated using a previously described pPB-TetON-mEGFP-HMGB1-MUT PiggyBac transposon (Addgene #194562)39 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Lentiviral particles containing the CD19 CAR element were produced by lipofectamine-based co-transfection of HEK293 cells with 3rd generation packaging plasmids pMD2.G (Addgene, #12259), pMDLg/pRRE (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by transfection of HEK-293T cells with lentiCRISPRv2 (sgC15, sgC40 or sgCtrl) and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lipofectamine™ 3000 transfection reagent in Opti-MEM medium was used to co-transfect HEK293T cells with psPAX2 (#12260, Addgene, USA), pMD2.G (# 12259 ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 x 106 cells were transfected using the calcium phosphate precipitation method (Salmon and Trono, 2007) with 6 μg pMD2.G (Addgene #12259), 15 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Immunology 2024Quote: HEK293T cells were transfected with 3 µg of pmirGLO plasmid containing the 3’UTR of Zc3h12a or Tnf (Addgene plasmid 207127) (7 ...
-
bioRxiv - Bioengineering 2023Quote: ... Murine Stem Cell Viruses (MSCV) were packaged using Platinum-E cells by co-transfection of MSCV retroviral transfer plasmids with pCL-Eco (Addgene #12371) using X-tremeGENE 9 DNA Transfection Reagent (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus expressing either Bmal1- or Per2-promoter driven luciferase reporter was produced by transfecting HEK293T cells with 6 µg psPAX2 (Addgene #12260), 3.6 µg pMD2G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: High-titre lentiviral supernatants were produced by transient transfection of 293T/17 cells with second-generation packaging/envelope vectors pRRE (Addgene #12251), pREV (Addgene #115989) ...
-
bioRxiv - Cancer Biology 2024Quote: Lentiviruses were made by Lipofectamine 2000-based co-transfection of 293FT cells with the respective lentiviral expression vectors and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles for cas9 and HSP90-alpha were produced using HEK293T cells by con-transfection of transgene plasmid and pMD2.G (Addgene# 12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Microbiology 2023Quote: ... Puromycin selection was performed until visual inspection showed a pure population of cells express zsGreen (which is part of lentivirus backbone, see plasmid Addgene #204579). At this point all cell stored libraries were frozen until further use.
-
bioRxiv - Physiology 2024Quote: ... Pparg1 or Pparg2 in NIH-3T3 cells was performed by transfecting pcDNA3.1(-) rat C/EBP alpha (#12550, Addgene, Watertown, MA, USA), pcDNA-mC/EBPb (#49198 ...
-
bioRxiv - Neuroscience 2023Quote: ... To express the calcium indicator GCaMP6s in neuronal cell bodies or long-range projection axons either AAV5-Syn-GCaMP6s or AAV1-Syn-GCaMP6s (1−1013 gc/mL; Addgene #100843) was injected into the relevant brain region ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Molecular Biology 2024Quote: ... To generate MPST-/- HeLa cells single guide RNAs (sgRNAs) against MPST (fwd: CACCGGCGTCGTAGATCACGACGT, rev: AAACACGTCGTGATCTACGACGCC) were subcloned into the plentiCRISPR V1 (Addgene 52963). Subcloned plasmids were co-transfected into HEK293T cells with lentiviral packaging vectors ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentivirus was generated by co-transfection of HEK293T cells with destination vector plasmid DNA and the packaging plasmids pMDLg/pRRE (Addgene, 12251), pRSV-Rev ...
-
bioRxiv - Cancer Biology 2024Quote: ... B7GG cells were transfected by Lipofectamine 3000 (Thermo Fischer) with rabies virus genomic vectors RabV CVS-N2cΔG-eGFP (Addgene plasmid #73461) or SAD-B19ΔG-eGFP (modified from Addgene plasmid # 32634) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 377 million iCas9-expressing NIH-3T3 cells were transduced with the Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Wang et al, 2017) (Addgene; 1000000096) using spinfection at an MOI of 0.3 to ensure a final library coverage of 500X ...
-
bioRxiv - Cell Biology 2024Quote: ... MEFs and MDA-MB-231 cells were stably modified using BFP and DN-KASH expression plasmids in a doxycycline-inducible Piggybac plasmid backbone (Addgene #187019). For lentiviral modifications ...
-
bioRxiv - Genomics 2024Quote: ... we nucleofected five million cells with five µg of spCas9/sgRNA-expression plasmids (pX330-U6-Chimeric-BB-CBh-hSpCas9, Addgene #42230) by Nucleofector 2b ...