Labshake search
Citations for Addgene :
1851 - 1900 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Structural and mechanistic insights into disease-associated endolysosomal exonucleases PLD3 and PLD4bioRxiv - Biochemistry 2023Quote: ... PLD3 KO cell line was generated from HEK293BlueTM hTLR9 by transfecting 2 μg hSpCas9-sgRNA expressing plasmid (Addgene #99154) cloned with gRNA sequence 5′-guccucauucuggcgguugu-3′ ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells at 80% confluence were transfected with a mix of 1.8 μg gag/pol packaging plasmid (Addgene #14887), 0.7 μg pRev packaging plasmid (Addgene #12253) ...
-
bioRxiv - Genomics 2024Quote: Lentivirus was produced from transfected HEK293T cells with packaging vectors (pMD2.G #12259, Addgene, and pCMV-dR8.91, Trono Lab) following the manufacturers protocol (#MIR6605 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Parental HEK293 cells were co-transfected with 1.0 µg each of PBKS-Cas9-2A-eGFP plasmid (Addgene plasmid #68371) and plasmid encoding for gRNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lenti-U6BC-sgDbl/Cre vectors were transfected as a pool into 293T cells with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Cell Biology 2024Quote: ... enables GFP and APEX to be targeted to cilia in many cell types via the N-terminal 203 residues of NPHP3 and was a gift from Maxence Nachury (RRID:Addgene_73186) (Mick et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected with the Lenti-iCas9-neo vector (Addgene plasmid #85400, a gift from Qin Yan) (Cao et al ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... MDA-LM2 and HCC1806-LM2 cells expressing dCas9-KRAB fusion protein were constructed by lentiviral delivery of pMH0006 (Addgene #135448) and FACS isolation of BFP-positive cells.
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transduced the next day with 1000 ng of plasmid DNA plus 250 ng pMD2.G (Cat# 12259, Addgene) and 750 ng psPax2 (Cat# 12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... SPRY2 CRISPR oligonucleotides used in A549 cells (gRNA target site: CGTACTGCTCCGCGACCCTG) were cloned into lentiCRISPR v2 plasmid (Addgene pasmid #52961). DUSP6 CRISPR oligonucleotides used in H1299 cells were cloned into lentiCRISPR v2 plasmid (gRNA target site ...
-
bioRxiv - Immunology 2021Quote: ... Lentiviral particles were produced in 293T cells using pMD2.G and psPAX2 (from Didier Trono, Addgene plasmids #12259 and #12260), and pINDUCER-21 plasmids ...
-
bioRxiv - Genetics 2021Quote: ... We introduced this into cells by transfection of 129/B6 XY ESC together with the spCas9 plasmid pX459 (Addgene #62988), carrying a single gRNA sequence complementary for the p53 3’-end ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 6-well plates (1.5×106 cells/well) and co-transfected with the cAMP sensor Pink Flamindo (Addgene plasmid #102356) and either empty vector or the given GPR126 construct in the pULTRA vector on the next day using Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... 293T cells were cotransfected with vectors encoding an RNA bait flanked by BoxB stem loops and the BASU biotin ligase (Addgene #107253 and #107250 ...
-
bioRxiv - Cell Biology 2022Quote: - AoSMC Inducible progerin-expressing cells: Lentiviral particles containing pLenti-CMV-TRE3GNeo-GFP progerin (gift from Tom Misteli (Addgene plasmid # 118710), pLentiCMV-TRE3G-GFP-laminA (gift from Tom Misteli (Addgene plasmid # 118709)) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell line inducibly expressing Flag-NSP2 was generated by co-transfecting pcDNA5-FRT-TO-FH-Nsp2 (Addgene plasmid 157683) and pOG44 (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: 144 million Lig4-/- abl pre-B cells were transduced with a viral tet-inducible guide RNA library (Pooled Library #67988, Addgene) containing 90,000 gRNAs targeting over 18,000 mouse genes ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The HEL and JURKAT SAMHD1-WT and SAMHD1-D311A cell lines were generated by co-transfection of the packaging vector pPAX2 (Addgene), either pHR-SAMHD1-WT or pHR-SAMHD1-D311A and a plasmid encoding VSV-G ...
-
bioRxiv - Cell Biology 2019Quote: ... DDRGK1 and UFL1 knockout cell lines were generated by transient transfection of two pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) plasmids carrying sgRNAs that each target the downstream and upstream regions of the transcription start site ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei of opsin-positive cells were visualized using a Histone2B fusion protein with mTFP1 (a gift from Robert Campbell & Michael Davidson; Addgene plasmid # 54553 ...
-
bioRxiv - Genomics 2020Quote: THP-1 and MV4;11 cells were engineered to stably express humanized S.pyogenes Cas9 endonuclease by lentiviral transduction with the FUCas9Cherry vector (Addgene 70182) and subsequent FACS-selection for mCherry-positive cells (THP-1-Cas9 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The day after when cells reached approximately 70% of confluence they were transfected with 3µg of the PEGFPC1 plasmid (Addgene #28176) using the Viafect reagent (Promega ...
-
bioRxiv - Genomics 2019Quote: Lentiviruses were produced by transfecting HEK293T cells with lentiviral pSMAL vector and packing plasmids pCMV-dR8.2 dvpr (Addgene plasmid 8455) and pCMV-VSV-G (Addgene plasmid 8454 ...
-
bioRxiv - Biophysics 2019Quote: Genetic constructs encoding the inward rectifying potassium channel Kir2.1 and the blue-shifted channelrhodopsin CheRiff were separately cloned into lentiviral expression backbones (FCK-CMV) and then co-expressed in HEK 293T cells along with the lentiviral packaging plasmid PsPAX2 (Addgene) and the envelope plasmid VsVg (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293/T17 cells were transfected with DNAJB1-PRKACA K128H plasmid along with psPAX2 (Addgene plasmid #12260, gift from Didier Trono) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Biochemistry 2019Quote: ... we selected a BRD2-expressing stable ARPE19 cell line using a lentivector constructed based on an empty vector (Addgene, 19319).
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Genetics 2019Quote: ... HEK293T cells were transfected using a calcium phosphate protocol with plasmids psPAX2 (a gift from Didier Trono, Addgene plasmid # 12260), pCAG-Eco (a gift from Arthur Nienhuis & Patrick Salmon ...
-
bioRxiv - Genetics 2021Quote: ... Pools of PiggyBac cargo plasmids that can be used to make peCHYRON cell lines will be made available from Addgene. All plasmids to be used for transfection were purified with HP GenElute Midi or Mini kits (Sigma # NA0200 and NA0150).
-
bioRxiv - Genetics 2021Quote: ... K562 cells endogenously expressing BE4 and FNLS were generated by infecting K562 cells with a lentiviral vector carrying a base editor and puromycin resistance genes (pLenti-BE4GamRA-P2A-Puro, Addgene 112673 ...
-
bioRxiv - Cell Biology 2021Quote: ... The HeLa GFP-RAB7 line was generated by transfecting HeLa cells (ATCC) with the donor plasmid pDONOR-GFP-RAB7 and pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, #62988) bearing the appropriate targeting sequence (5’-TAGTTTGAAGGATGACCTCT-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... ACTB repair template AICSDP-15: ACTB-mEGFP was a gift from The Allen Institute for Cell Science (Addgene plasmid # 87425). SOX9 repair template was created by Infusion (638909 ...
-
bioRxiv - Genomics 2021Quote: ... cells constitutively expressing dCas9KRAB were transduced with a library of gRNAs cloned into the CROP-seq-opti vector (Addgene #106280) in order to capture gRNA information on the 10X platform ...
-
bioRxiv - Cancer Biology 2020Quote: EKVX cells (4×105) were plated in 6-well plates and were transfected with 3μg of linearized lentiCas9-Blast (Addgene, 52962) using lipofectamine 2000 (11-668-019 ...
-
bioRxiv - Bioengineering 2021Quote: ... Lentiviral particles were made by transfecting HEK293T cells with the plasmid of interest and with packaging plasmids (3rd generation Lentiviral system from Addgene). Replication incompetent virus was collected using a BL2+ safety protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentivirus to express Cre recombinase was produced by transfecting NIH HEK293T cells with Cre-IRES-PuroR plasmid (Addgene plasmid #30205), Δ8.9 and VSV-G ...
-
bioRxiv - Cancer Biology 2020Quote: ... and lentiviral particles for sgRNA were produced in HEK293T cells by co-transfecting pLXsgRNA plasmid with pMD2.G (Addgene# 12259) and psPAX2 (Addgene #12260).(Supplementary table 2a ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Expi293F cells were transfected with pcDNA3-SARS-CoV-2-S-RBD-sfGFP (a gift from Erik Procko, Addgene plasmid # 141184) using ExpiFectamine™ 293 Transfection Kit according to manufacturer’s directions (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLenti CMV rtTA3 Hygro (w785-1) used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434 ...
-
bioRxiv - Systems Biology 2021Quote: ... HEK293FT cells were transfected with one of the three destination vectors plus a lentiviral packaging vector (psPAX2, Addgene plasmid #12260) and a VSV-G envelope expressing vector (pMD2.G ...
-
bioRxiv - Microbiology 2021Quote: ... A549 PAF1 and STAT2 rescue cells were created by cloning PAF1 and STAT2 cDNA into pLenti6 plasmid (Addgene #89766, 54). Lentiviral packaging was performed as described above ...
-
bioRxiv - Biochemistry 2021Quote: ... bacterial cells were co-transformed with the SDC-containing plasmid and pULTRA-CNF (Addgene # 48215, a gift from Peter Schultz) [14] ...
-
bioRxiv - Molecular Biology 2021Quote: ... The MBD2 KO and MBD3 KO cell lines were generated by co-transfecting pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230) with two sgRNA targeting exon 1 for MBD2 KO cell line (sg1_GACTCCGCCATAGAGCAGGG ...
-
bioRxiv - Microbiology 2021Quote: ... lentiviruses were produced in HEK293T cells by co-transfection of library plasmids together with the packaging plasmid psPAX2 (Addgene 12260) and envelope plasmid pMD2.G (Addgene 12259) ...
-
bioRxiv - Systems Biology 2021Quote: U2OS cells stably expressing a membrane-targeted form of eGFP were generated by transfection with plasmid Lck-GFP (Addgene #610992) and culturing in selection medium (DMEM medium containing 10% FBS ...
-
bioRxiv - Microbiology 2020Quote: BHK21-Cas13b cell line was transduced with lentivirus carrying TRE-mCherry reporter cassette (generated from pLV-tetO-mCherry, Addgene #70273). The transduced cells were sorted for mCherry+ cells ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... and after selection in 300 μg/ml G418 cells were tagged with luciferase by transduction with lentiviruses expressing pFU-Luc2-eGFP (Addgene).