Labshake search
Citations for Addgene :
2101 - 2150 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Viral particles for the generation of stable overexpressed cell lines were produced by co-transfection of pLEX_307 (a gift from David Root, Addgene plasmid # 41392) containing the target gene ...
-
bioRxiv - Cell Biology 2020Quote: HAP1 wt cells as well as single cell-derived clones were obtained from Haplogen Genomics or generated in-house by transient transfection with px459 (Addgene #48139) vectors carrying sgRNAs against the selected genes ...
-
bioRxiv - Immunology 2021Quote: ... produced in HEK293FT cells transiently transfected with two packaging plasmids (psPAX2 and pMD2-G) and the lentiCRISPR v2 plasmid (Addgene #52961)11 containing a non-targeting (GGCATCTTAACTAATCGTCT ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Cell Biology 2021Quote: ... Lig4-/-:53bp1-/- and Lig4-/-:53bp1-/- cell lines were made by transiently transfecting 53bp1 or Lin37 guide RNAs (gRNAs) in the pX330 vector (Addgene# 42230) into WT or Lig4-/- cells followed by subcloning by limited dilution ...
-
bioRxiv - Physiology 2021Quote: A549 cells (NCI-DTP Cat# A549, RRID:CVCL_0023) were identically transfected with GFP-eNOS (provided by W. Sessa, Addgene plasmid #22444; RRID:Addgene_22444) and/or mCherry-HSP90 (provided by D ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentivirus was produced by co-transfection of HEK293T cells with a lentiviral vector and the packaging plasmids psPAX2 (Addgene, plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were transfected with a combination of three plasmids: 5 μg of pMD2.G (gift from Didier Trono, Addgene plasmids #12259), 15 μg of psPAX2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Microbiology 2020Quote: ... A549-ACE2-Cas9 cells were generated by transduction of A549-ACE2 cell line with a packaged lentivirus expressing the mCherry derived from the lentiCas9-Blast (Addgene #52962) that the blasticidin resistance gene was replaced by mCherry ...
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 Tet on cells were generated by transduction of Huh-7 cells with lentivirus generated using the pCW57.1 plasmid (gift from David Root, Addgene plasmid # 41393).
-
bioRxiv - Immunology 2021Quote: ... LentiGuide-Puro empty vector (control) or SP140 gRNA cloned plasmids were then co-transfected into HEK293T cells with the packaging plasmids pVSVg (AddGene 8454) and psPAX2 (AddGene 12260 ...
-
bioRxiv - Cell Biology 2021Quote: ATM KO HMC3 cells were generated using a vector encoding SpCas9(D10A) nickase (kind gift of Feng Zhang; Addgene plasmid #48141) (65 ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 CRISPR/Cas9 edited cell lines were generated by first isolating clones with doxycycline-inducible expression of Cas9 (Addgene, 50661), then infected with lentivirus harboring the sgRNA and selected with 4 μg/ml blasticidin ...
-
bioRxiv - Cell Biology 2021Quote: ... To generate Ftractin-mCherry stable STIM1-10A and WT MEFs, cells were infected with lentivirus expressing Ftractin-mCherry (Hayer et al., 2016) (Addgene #85131). The plasmid pLenti-EB1-EGFP was obtained from Addgene (plasmid # 118084) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA-mediated knockdown of CCL5 and CXCL10 in the dMMR MC38 cells was achieved using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Stably knocked down cells were selected with 250 ug/ml hygromycin and knockdown was confirmed by Western blot.
-
bioRxiv - Microbiology 2020Quote: ... cDNA used to generate ACE2 positive cells was constructed as follows: the ACE2 PmeI cDNA fragment obtained from the plasmid hACE2 (Addgene; #1786) was cloned in pMD2iPuror opened in EcoRV.
-
bioRxiv - Cancer Biology 2022Quote: MCF10A MND1 and PSMC3IP CRISPRi cell lines were generated by cloning sgRNAs into the BbsI site of the pKLV5-U6sgRNA5-PGKPuroBFP (Addgene # 50946), as previously described (Tzelepis et al. ...
-
bioRxiv - Cell Biology 2022Quote: Lentivirus preps were produced in 293FT cells transfected with lentiviral delivery vectors together with second generation packaging system consisting of psPax2 (Addgene 12260), and pMD2.G (Addgene 12259 ...
-
bioRxiv - Cell Biology 2022Quote: All lentiviral productions were done by transfecting 293T cells with equal amount of lentiviral packaging combo (pMDLg/pRRE (Addgene Plasmid #12251), pRSV-Rev (Addgene Plasmid #12253) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viral supernatants were prepared by transfection of HEK293T cells with the vector plasmids and packaging plasmids (psPAX2 Addgene 12259 and pMD2.G Addgene 12260). The transfection was performed with polyethylenimine (PEI MAX Transfection Grade Linear Polyethylenimine Hydrochloride ...
-
bioRxiv - Cancer Biology 2022Quote: ... The lenti-vectors expressing each pair of gRNAs targeting distal enhancers were packaged in 293T cells using pMD2.G (Addgene # 12259) and psPAX (Addgene # 12260) ...
-
bioRxiv - Biochemistry 2022Quote: ... lentivirus was produced by co-transfection of HEK293T cells with a lentiviral vector and the packaging plasmids psPAX2 (Addgene, plasmid #12260) and pMD.2G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell line used for CRISPRi screen was generated by lentiviral transduction of MCF10A TP53-/- cells with lenti-BLAST-dCas9-KRAB (Addgene, #89567) followed by selection with 10 μg/mL blasticidin ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cas9-expressing cells were generated as follows: each parental cell line was incubated with lentivirus corresponding to the pLX_311-Cas9 plasmid (Addgene plasmid #96924), encoding the Cas9 protein ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Cell Biology 2022Quote: RPE-1.iPLK4 and RPE-1.iPLK41-608 cell lines were generated using pLenti-CMV-TetR-Blast lentiviral vector (Addgene, 17492) and selected using Blasticidin (10 µg/mL) ...
-
bioRxiv - Genomics 2022Quote: ... Viral particles were produced by transient transfection of HEK293T cells with the library and packaging plasmids pMD2.G (Addgene no. 12259) as well as psPAX2 (Addgene no ...
-
bioRxiv - Microbiology 2022Quote: ... in DMEM+10% FBS supplemented with 20 μg/ml G418 to select for transduced cells.Selection was repeated for 6 passages and selected cells were expanded into 24 well plates and transfected with pX330-U6-Chimeric_BB-CBh-hSpCas9 (#42230; Addgene, Watertown, MA) by Trans IT LT-1 (Mirus Bio ...
-
bioRxiv - Systems Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Neuroscience 2023Quote: ... pLVX-UbC-rtTA-Htt-Q94-CFP vector was co-transfected in HEK293T cells using Lipofectamine2000 with packaging vectors pMD2.G (Addgene, #12259) and psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Spike protein pseudotyped luciferase-expressing lentivirus preparation, HEK293T cells were transfected with FUW-RLuc-T2A-PuroR(Kanarek et al., 2018) (Addgene, MA), psPAX2 and pUNO1-SARS2-S (D614G ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviruses were produced by triple transfection of HEK-293T cells with the lentiviral transfer vector pLenti6.3/TO/V5-Blasti and the packaging plasmids psPAX2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Genome-wide CRISPR/Cas9 positive selection screens were performed as previously reported.51 KBM7 cells constitutively expressing Cas9 (KBM7-Cas9, 250 million) were transduced with the Brunello sgRNA library (Addgene #12260) at a multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded at 20% confluence and infected with lentivirus generated from pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang (41)) engineered to deliver Cas9 and a gRNA targeting LMAN1 (CCCCTTACACTATAGTGACG) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Cell Biology 2022Quote: ... replication-deficient lentiviruses were produced and titrated as described by co-transfection of the resulting constructs in HEK-293T cells with the HIV-1 packaging plasmid psPAX2 (Addgene #12260) and the plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: NRK/TRIM21 cells stably expressing mCherry-TRIM21 were generated by transducing NRK cells with lentiviral particles that were produced by co-transfection of HEK293T cells with pSMPP- mCherry-hTRIM21 (a gift from Leo James, Addgene # 104972), psPAX and pVSVG using PEI Max (Polysciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... Polyethyleneimine was then used to co-transfect the cells with reporter plasmid [pCINeo-GFP (obtained from Christopher Buck, NIH) or pCAG-HcRed (Addgene #11152)] and p16sheLL expressing HPV16 L1 and wild-type or mutant L2 ...
-
bioRxiv - Microbiology 2022Quote: ... U-2 OS cells stably expressing the Bmal1 promoter in front of luciferase (Bmal1-luc) were generated using the pABpuro-BlucF plasmid (Addgene #46824) and maintained in 2 µg/ml puromycin (Life Technologies) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... in vivo confocal imaging was used in cells co-transfected with the FRET-based ER-ZapCY1 probe (Addgene, Catalog nr. 36321)[75] and ZnT9-50Met ...
-
bioRxiv - Cell Biology 2023Quote: ... viruses were produced in HEK 293T cells by transfecting the corresponding plasmid o interest as well as with pVSVg (Addgene, #8454) and psPAX2 (Addgene ...
-
bioRxiv - Systems Biology 2023Quote: The CRISPRi Calu-3 cell line was generated by lentiviral delivery of pMH0001 (UCOE-SFFV-dCas9-BFP-KRAB) (19) (Addgene #85969) into Calu-3 cells ...
-
bioRxiv - Cell Biology 2023Quote: STING1 KO HMC3 cells were generated using the pSpCas9(BB)-2A-Puro (PX459) V2.0 vector kindly gifted by Feng Zhang (Addgene plasmid #62988)73 containing the following single guide RNA (sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... 72hrs post transfection cells from both siMCU and siNT conditions were transfected with 1ug of eGFP-NFAT2 overexpression plasmid (Addgene#24219) using Lipofectamine 2000 reagent according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: 1.6 x 108 A375 cells were transduced into thirty-two 150 mm plates with lentivirus carrying The Toronto Knockout Library v3 (TKOv3, Addgene # 90294) in standard culture media + 8 µg/mL polybrene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Due to the Purmocyin resistance the XEN-dCas9-BFP-KRAB cells were infected with a modified version of the pLKO5.GRNA.EFS.PAC vector (Addgene, cat. no. 57825) replacing puromycin with blasticidin resistance ...
-
bioRxiv - Neuroscience 2023Quote: ... For optogenetic activation of PRF/GlyT2+ cells we injected AAV5.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (based on Addgene plasmid #20298, UNC Vector Core) or for control AAV5.EF1a.DIO.eYFP.WPRE.hGH (based on Addgene plasmid #27056 ...
-
bioRxiv - Genomics 2023Quote: ... 4M cells were plated in a 10cm dish for 24-hours before transfecting HEK293T cells with 9ug of dCas9-mCherry-KRAB (Addgene #60954), 4ug of packing plasmids psPAX.2 and 2ug of the envelope vector pMD2.G diluted in OptiMEM medium and Trans-Ltl transfection reagent (Mirus) ...
-
bioRxiv - Genomics 2023Quote: The A549-TetR-Cas9 cell line was created by simultaneously transfecting A549 cells with piggyBac transposase and a piggyBac cargo plasmid containing TetR-inducible Cas9 (Addgene #134247), and selecting for 7 days with 500 ug/mL G418 ...