Labshake search
Citations for Addgene :
1801 - 1850 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Polyclonal SK-N-DZ cells constitutively expressing the CRISPR activation machinery were engineered by transducing wild-type cells with lentiviral particles carrying a dCas9-VP64 (lenti dCas9VP64_Blast, Addgene plasmid #61425 was a gift from Feng Zhang ...
-
bioRxiv - Cancer Biology 2022Quote: ... and the resulting pQCXIN-PD-L1-IRES-Thy1.1 plasmid was transfected into HEK293T cells along with pCMV-VSV-G (a gift from Bob Weinberg; Addgene plasmid 8454 ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Systems Biology 2019Quote: MCF10A cells were transduced with nuclear RFP-expressing lentivirus (LV-RFP, a gift from Elaine Fuchs, Addgene plasmid #26001) and treated under conditions listed in Table 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse Sp7 and GFP lentiviruses were generated by transfecting HEK293T cells with a blasticidin resistance backbone (Addgene, plasmid 26655) along with psPAX2 and MD2.G ...
-
bioRxiv - Molecular Biology 2021Quote: The cell cycle reporter vector pCSII-EF-miRFP709-hCdt(1/100) was a kind gift from Vladislav Verkhusha (Addgene plasmid # 80007 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Lentiviral particles were produced in 293T HEK cells by co-transfection of the lentiviral pCW57.1_Gata6 plasmid with VSV-G (pMD2.G, Addgene #12259) and helper plasmid (psPAX2 ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were transfected with plasmid encoding eSpCas9(1.1) and sgRNAs targeting CCT5 and ATP1A1 (modified from Addgene #86613) along with linear dsDNAs to act as HDR templates by which to insert 3xFLAG/Spytag at the C-terminus of CCT5 ...
-
bioRxiv - Biochemistry 2021Quote: ... we transfected HEK293T cells with Cas9 and sgRNA targeting the gene encoding for the CCT5 subunit (Addgene eSpCas9(1.1) vector ...
-
bioRxiv - Genetics 2020Quote: ... We generated cell lines expressing KRAB-dCas9-IRES-BFP under the control of a doxycycline-inducible promoter (Addgene #85449) and the reverse tetracycline transactivator (rtTA ...
-
bioRxiv - Cell Biology 2020Quote: ... the LoxStopLox cassette was removed by transfecting the cells with LV-Cre (from Inder Verma via Addgene, plasmid # 12106) using the previously described transfection protocol ...
-
bioRxiv - Cell Biology 2020Quote: The plasmid carrying Cas9/sgRNA was co-transfected into HEK293FT cells with the lentiviral packaging vectors psPAX2 (Addgene #12260) and VSV-g (Addgene #8454 ...
-
bioRxiv - Immunology 2021Quote: ... Virus was harvested from GP-2 cells transfected with SINV vectors and VSV-G (pMD2.G, Addgene plasmid #12259) and grown in DMEM supplemented with 30% FBS and 2mM glutamine ...
-
bioRxiv - Cancer Biology 2021Quote: ... the adherent cell cultures were cultured in the presence of lentiviral particles containing ΔLTR flanked CMV:tdTomato-blasticidin (Addgene#106173) and 8µg/mL polybrene (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: Lis1 shRNA Lentiviral particles were prepared in HEK293T cells and RAW 264.7 macrophages were transduced with these particles using protocol as recommended by Addgene. Transductant cells were selected on Puromycin (2.5 µg/mL) ...
-
bioRxiv - Neuroscience 2022Quote: ... chr.14 5’-AAGAAAGAAACTTGGCATAG-CAG 14:56,271,668-56,271,690) was assessed in transfected HeLa cells using TurboRFP open reading frame reconstitution reporter plasmid (pAR-TurboRFP; Addgene #60021) as described previously (Kasparek et al. ...
-
bioRxiv - Cell Biology 2022Quote: Lentiviral supernatants were produced in HEK293Lx cells following transfection with 3rd generation packaging plasmids and either pLKOshp53 (Addgene #19119), pLKOshScr (Addgene #1864) ...
-
bioRxiv - Bioengineering 2022Quote: ... To generate H2B-iRFP lentiviral particles HEK 293T cells were plated in a 6-well plate (7×105 cells per well) and transiently transfected with 1.5 μg of pLenti-pGK-DEST-H2B-iRFP vector (Addgene # 90237 ...
-
bioRxiv - Cell Biology 2022Quote: Lentivirus was generated by co-transfecting HEK293T cells with two packaging plasmids (pCMV-VSV-G and delta8.9, Addgene #8454) and the desired transfer plasmid using TransIT-293 transfection reagent (Mirus) ...
-
bioRxiv - Cell Biology 2022Quote: ... hTERT-RPE1 Plk1 FRET Sensor cells were prepared by transfecting Plk1-FRET sensor c-jun substrate plasmid37 (Addgene: 45203) in hTERT-RPE1 cells using X-tremeGENE™ 9 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral particles were produced in 293T cells by using psPAX2 and pCMV-VSV-G packaging plasmids (Addgene 12260, 8454). Viral supernatant was collected after 48h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviral particles were produced in 293T cells by transfecting pCG-gag-pol and pCMV-VSV-G packaging plasmids (Addgene) together with the corresponding retroviral plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: CRISPR mediated mutagenesis of target genes was performed by transducing K562 cells stably expressing Cas9 (lentiCas9-Blast, Addgene #52962) with lentivirus expressing sgRNAs (lentiGuide-Puro ...
-
bioRxiv - Neuroscience 2022Quote: ... N2a cells were co-transfected with the wild-type or FeRIC channels and GCaMP6 (GCaMP6 medium, Addgene cat.40754) or YFP-H148Q ...
-
bioRxiv - Microbiology 2022Quote: ... Lentiviruses containing shRNA or sgRNA were produced using 293FT cells with packaging constructs pCMV-VSVG and pCMV-Delta 8.2 (Addgene). The lentiviruses were collected 48 hrs post transfection and concentrated by ultracentrifugation at 25,000 rpm for 2 hrs ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Bioengineering 2022Quote: ... Lentivirus was produced using calcium phosphate co-transfection of HEK293T cells with the psPAx2 plasmid (packaging vector, Addgene #12260), pMd2g plasmid (VSVG envelope ...
-
bioRxiv - Microbiology 2023Quote: ... Lentiviral packaging was carried out in HEK293T cells using the 3rd generation packaging plasmids pCMV delat R8.2 (#12263; Addgene) and pCMV-VSVG (#8454 ...
-
bioRxiv - Developmental Biology 2023Quote: ... viral lenti-particles were generated by transfecting HEK293 cells in a T25 flask with 15 μg of the lentiviral WβS-reporter vector (7TGC; Addgene #24304 ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Cell Biology 2023Quote: Whole-genome CRISPR screens were performed in U2OS and U2OSp53KO cells using the GeCKOv2 two-vector system (Addgene, #1000000049). The two pooled DNA half-libraries (A and B ...
-
bioRxiv - Immunology 2023Quote: ... Retrovirus were produced by transfecting HEK 293T cells with a mixture of PD-L1-pMIT1.1 (or PD-L2-pMIT1.1) and pCL-Eco (Addgene #12371) using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentiviral vectors were co-transfected into 293T cells with the packaging vectors pCMV-dR8.2 dvpr and pCMV-VSV-G (Addgene). Virus-infected cells were selected with 2 μg/ml puromycin ...
-
bioRxiv - Cell Biology 2023Quote: ... Gene knockdown was performed in a sub-clonal K562 cell line stably expressing dCas9-KRAB-BFP (Addgene plasmid #102244), generously provided by Eric J ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transiently transfected with Cas9 and single guide RNAs plasmids with EGFP expression (PX458; Addgene plasmid no. 48138). The single guide RNAs targeting CDK6 and CDK4 (sequences TTAGATCGCGATGCACTACT and ATCTCGGTGAACGATGCAAT respectively ...
-
bioRxiv - Genomics 2023Quote: ... Cells were transfected with each DNMT3B or GFP-only construct in addition to pCMV-dR8.2 dvpr (Addgene, plasmid #8455) and pCMV VSV-G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable sgCTRL and sgHORMAD1 cell lines were generated using pLX-sgRNA and pCW-Cas9 constructs (Addgene plasmid #50662, #50661) as described previously (Nichols et al. ...
-
bioRxiv - Microbiology 2023Quote: ... while long-term single-gene knockout cell lines were generated using sgRNAs in pLenti SpBsmBI sgRNA Hygro (Addgene, 62205) containing a hygromycin resistance cassette ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral particles were produced in HEK293T cells using psPax2 and pMD2.g second-generation packaging plasmids (Addgene #12260, #12259) with jetPRIME Polyplus transfection reagent ...
-
bioRxiv - Cancer Biology 2023Quote: Derivatives of KP and KPK cells were generated by stable lentiviral transduction of Cas9 with blasticidin resistance (Addgene#52962). Cells were maintained with blasticidin selection throughout the experiment ...
-
bioRxiv - Biochemistry 2023Quote: ... cells with pKS18 and the lentiviral packaging vectors pMD2.G (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene 12259), pRSV-Rev (Addgene plasmid #12253 ...
-
bioRxiv - Developmental Biology 2023Quote: ... a clone of EUC313f02 NipblFLEX/+ ES cells (European Conditional Mouse Mutagenesis Program) was transfected with pCAG-Cre:GFP (Addgene #13776) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK-293T cells were transfected with the respective genome library along with helper plasmids pCAG-B19N (Addgene cat. # 59924), pCAG-B19P (Addgene cat ...
-
bioRxiv - Microbiology 2023Quote: N4BP1 KO Huh7 cells were generated by CRISPR/Cas9 using pX330-U6-Chimeric_BB-CBh-hSpCas9 (pX330, Addgene, MA, USA) and HR110PA-1 (System Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... hGM-CSF and hIL-4 were produced from HEK293 cells stably transduced with pAIP-hGMCSF-co (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
bioRxiv - Biochemistry 2023Quote: Luciferase reporter assays were performed in MEF cells transfected with a UCP3 reporter plasmid[18] (UCP3 EP1, Addgene #71743) or PGC-1α 2kb promoter (Handschin et al ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids used for CRISPR KO cells lines lentiCRISPR v2 and lentiCRISPR v2-Blast were originally from Feng Zhang (Addgene plasmid # 52961 ...
-
bioRxiv - Microbiology 2024Quote: ... pseudovirus constructs (PV) have been developed by three-plasmid co-transfection in HEK293 cells using lentiviral backbone (Addgene # 8455), firefly luciferase reporter (Addgene #170674 ...
-
bioRxiv - Immunology 2024Quote: Pseudo-lentiviral particles containing sCD177 construct were generated using 293T cells and packaging vectors pMD2.G and pCMV-dR8.74psPAX2 (Addgene). Pseudo-lentiviral particles were transduced into the FreeStyle 293-F cells (ThermoFisher Scientific) ...