Labshake search
Citations for Addgene :
2201 - 2250 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... To generate MPST-/- HeLa cells single guide RNAs (sgRNAs) against MPST (fwd: CACCGGCGTCGTAGATCACGACGT, rev: AAACACGTCGTGATCTACGACGCC) were subcloned into the plentiCRISPR V1 (Addgene 52963). Subcloned plasmids were co-transfected into HEK293T cells with lentiviral packaging vectors ...
-
bioRxiv - Immunology 2024Quote: ... MP5-Hif1α KO lines were made via transducing MP5 cells with sgHif1a or sgNT cloned into lentiCRISPRv2-GFP (Addgene, plasmid #82416) and sorting for GFP.
-
bioRxiv - Neuroscience 2024Quote: iPS cells were transduced with a Lentivirus expressing GFP under activation of WNT signaling (Lentiviral-Top-dGFP reporter, Addgene plasmid #14715). Puromycin (1μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... MEFs and MDA-MB-231 cells were stably modified using BFP and DN-KASH expression plasmids in a doxycycline-inducible Piggybac plasmid backbone (Addgene #187019). For lentiviral modifications ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Biophysics 2021Quote: Clones of MDCKII expressing GFP-myosin-2-A were created by transfecting cells with pTRA-GFP-NMCH II-A plasmid (Addgene plasmid # 10844). Stable expressing clones were selected via Neomycin resistance (G418) ...
-
bioRxiv - Biophysics 2020Quote: ... we overexpressed lamin A by transiently transfecting the intact cells with m-Cherry tagged plasmid DNA for lamin A which was a gift from Michael Davison (Addgene, plasmid # 55068). To surpass lamin A expression ...
-
bioRxiv - Cancer Biology 2021Quote: The lentivirus was packed in HEK293T cells by transfecting lentiviral expression vector plasmids together with the lentiviral packaging plasmid (psPAX2, Addgene plasmid # 12260) and the envelope protein expressing plasmid (VSV-G ...
-
bioRxiv - Cell Biology 2020Quote: For the generation of stable A549 cell lines expressing various PKCs and mutants we used following plasmids: pcDNA3-PKCε-Flag (wild-type, Addgene, Cambridge, MA), pcDNA3-Flag-K312PKCε ...
-
bioRxiv - Cell Biology 2020Quote: The ATF4-SunTag reporter was stably integrated into a previously-described HeLa-11ht cell line stably expressing GFP-tagged single-chain antibodies (scFvGFP) against GCN4 (Addgene plasmid #104998) and NLS-stdMCP-stdHalo fusion proteins (Addgene plasmid #104999 ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids: 0.5×106 target cells were cultured in 6-well plates and transfected with pEGFP-SKL (Addgene#53450 from Jay Brenman Lab) plasmids using TurboFect Transfection Reagent (Thermo-Scientifics R0531 ...
-
TSG101 Associates with PARP1 and is Essential for PARylation and DNA Damage-induced NF-κB ActivationbioRxiv - Molecular Biology 2021Quote: ... The lentiCRISPRv2 vectors (30 µg) containing respective guide RNAs were transfected to the cells together with 20 µg of psPAX2 (Addgene, Cat#8454) and 10 µg of pCMV-VSV-G (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... was randomly integrated in the genome of the target cell line via lentiviral transduction of a modified version of pHR-SFFV-dCas9-BFP-KRAB (Addgene plasmid # 46911) carrying a P2A blasticidin selection and UCOE element (kind gift of Marvin Tanenbaum) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cyclin and Geminin modules were amplified from cDNA of the murine CH12 cell line and Cas9 from described plasmids (Addgene plasmid #43861) [36] ...
-
bioRxiv - Bioengineering 2019Quote: For functional experiments in H2170 knocked-in cells we used (FLAG) Snail 6SA (active Snail) plasmid which was a gift from Mien-Chie Hung (Addgene plasmid # 16221) [16] ...
-
bioRxiv - Immunology 2019Quote: ... We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661). We cultured transduced cells in 3.0 μg/ml blasticidin (Invivogen ...
-
bioRxiv - Cancer Biology 2019Quote: ... 293T cells were transfected with the sgRNA vector and a 1:1:1 mixture of lentiviral packaging constructs (Addgene #12251, #12253, #8454) using polyethylenimine transfection reagent ...
-
bioRxiv - Microbiology 2019Quote: ... was used as target cells and was generated by retroviral transduction with the pMSCV-loxP-dsRed-loxP-eGFP-Puro-WPRE vector (Addgene, plasmid 32702) (76) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Cancer Biology 2020Quote: To generate lentiviral particles for SMPD3-P2A-Luc2 GFP and Luc2 GFP the lentiviral vector was packaged in LentiX HEK293T cells using the packaging plasmids psPAX2 (Addgene Plasmid #12260) and pMD2.G (Addgene Plasmid #12259) ...
-
bioRxiv - Genetics 2019Quote: ... The cloned lentiCRISPR vectors were individually transfected to HEK293FT cells with the packaging vectors psPAX2 (gift from Didier Trono; Addgene plasmid #12260) and pCMV-VSV-G (a gift from Bob Weinberg ...
-
bioRxiv - Cancer Biology 2020Quote: For this assay cells were co-transfected with M50 Super 8x TOPFlash (which was a kind gift from Randall Moon, Addgene, Cat #12456) 12 and pRL-TK (Promega ...
-
bioRxiv - Systems Biology 2021Quote: Growing REF/E23 cells were kept at sub-confluence and transfected with pfmh-hCry1 (a gift from Aziz Sancar; Addgene plasmid #25843) and pAdTrack-CMV FLAG Rev-erbα expression vectors (a gift from Bert Vogelstein ...
-
bioRxiv - Cell Biology 2021Quote: ... or ‘CRISPR-control’ (vector with no insert) HeLa cell lines were generated by lentiviral transduction using the lentiCRISPRv2 plasmid (a gift from Feng Zhang - Addgene plasmid #52961). Cells were selected with 3µg/mL puromycin until complete uninfected cell death occurred ...
-
bioRxiv - Cancer Biology 2020Quote: ... NCI-H3122 and EKVX cells were stably transfected with pKrasG12C or its homologous GFP backbone plasmid without KrasG12C (pC; Addgene #64336; Bicistronic_GFP_ires_puro) using previously established methods (Agalioti et al. ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... SH-SY5Y cells stably expressing YFP-alpha-synuclein were obtained by lentiviral transfection using 3rd generation lentiviruses (Addgene constructs: 12251, 12253, 12259) (67) ...
-
bioRxiv - Neuroscience 2020Quote: ... Viral vector stocks were produced by calcium phosphate transfection of 293FT cells in combination with packaging vectors psPAX2 (a generous gift from Didier Trono; Addgene plasmid # 12260) for lentiviral constructs ...
-
bioRxiv - Biochemistry 2021Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, 12259) and pTAT (kind gift of P ...
-
bioRxiv - Microbiology 2021Quote: ... Infectious viral particles with each of these lentiviral constructs were produced by co-transfecting 293T cells with packaging plasmid psPAX2 (Addgene, Cat#12260) and Env Vector pCMV-VSVg (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... A control cell line was generated by infecting U2OS cells stably expressing a non-targeting sgRNA (above) with the lentivirus vector pLKO.1-blast-Scramble (Addgene, cat# 26701) expressing a non-targeting shRNA sequence and selected with 15µg/ml blasticidin for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: ... CRISPR-edited HaCaT BACH1-KO and HaCaT NRF2-KO/BACH1-KO cells were generated by transfecting either HaCaT WT or HaCaT NRF2-KO cells with two different pLentiCRISPR-v2 (a gift from Dr Feng Zhang, Addgene plasmid #52961) containing each one a guide RNA against the first exon and the second exon of BACH1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Raji or SKW6.4) were infected with Cas9 expressing viruses that were produced in HEK293T cells transfected with the lentiCas9-Blast (#849, Addgene plasmid #52962), pMD2.G ...
-
bioRxiv - Cell Biology 2021Quote: ... BY4741 cells and mutant strains from the BY4741 gene knockout library were made prototrophic by transformation with the pHLUM plasmid (Addgene, Watertown, Massachusetts) [40] ...
-
bioRxiv - Cancer Biology 2021Quote: ... or RUNX1ΔEx6 amplified from cDNA obtained from 293T cells and the pINDUCER-21-RUNX1 plasmid (Addgene plasmid #97043; http://n2t.net/addgene:97043; RRID:Addgene_97043 (Sugimura et al., 2017)) ...
-
bioRxiv - Biochemistry 2022Quote: ... VSV-G-pseudotyped lentivirus was generated by cotransfection of HEK-293T cells (CRL-3216, ATCC, Manassas, VA) with psPAX2 (gift from Didier Trono, Addgene plasmid #12260), pMD2.G (gift from Didier Trono ...
-
bioRxiv - Biophysics 2022Quote: ... media was refreshed with standard growth media and cells were co-transfected with SNAP-mGluR2 (no FLAG-tag) and chimeric G protein (Gqo5, Addgene plasmid #24500) (1:2 w/w ...
-
bioRxiv - Cancer Biology 2022Quote: MCF7 cells engineered to express dCAS9-KRAB (details in main methods) and parental MCF7 cells were infected with the pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W plasmid (Addgene plasmid # 67980). For the infection the virus was generated in 293FT cells transfected with PAX2 and pMD2.G plasmids together with the pKLV2-U6gRNA5(gGFP)-PGKBFP2AGFP-W plasmid using the X-tremeGENE reagent (Roche) ...
-
bioRxiv - Cell Biology 2022Quote: ... INS-1 832/3 EV or g1-2 SNAP-GLP-1R cells were transfected with the pCI HA NEDD4 construct (a gift from Prof. Joan Massague, Addgene plasmid #27002) 24 hours before the experiment ...
-
bioRxiv - Immunology 2020Quote: ... DT40 CL18 Fam72a−/− cells were obtained by transfecting DT40 CL18 with Nucleofector™ Kit V four constructs in PX458 (Addgene, plasmid #48138) targeting Fam72a (1.5μg each ...
-
bioRxiv - Molecular Biology 2020Quote: ... EJ5-GFP HCT116 cells and EJ5-GFP U2OS reporter cells were similarly generated by selecting stable clones after electroporation of HCT116 and U2OS cells with XhoI linearized pimEJ5-GFP (25) (Addgene, plasmid 44026) DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... Tetracycline-inducible MYH12A WT and S1AS2A-mutant IA32 cell lines were made by first preparing a stable rtTA-expressing IA32 cells using pLenti-CMV-rtTA3-hygro lentivirus infection (virus made with Addgene plasmid 26730) and selection with 100 μg/mL hygromycin ...
-
bioRxiv - Microbiology 2021Quote: ... FMNL3-V5 was expressed in U937 FMNL3 KO using lentiviruses generated in 293E cells co-transfected with the packaging constructs psPAX2 (Addgene plasmid 12260) and pCMV-VSV-G (Addgene plasmid 8454).
-
bioRxiv - Cancer Biology 2020Quote: ... To knock-out Psat1 in cells isolated from MYC-driven tumours induced in Psat1fl/fl mice the retroviral vector MSCV-CreERT2 puro (Addgene plasmid #22776) was used ...
-
bioRxiv - Cancer Biology 2020Quote: ... The resulting HeLa-dCas9 cells were then transduced with the lentiviral construct for the MS2-P65-HSF1 (MPH) activator complex (Addgene 61426-LVC) and selected with 0.5 mg/ml hygromycin ...
-
bioRxiv - Cancer Biology 2019Quote: The B-cell acute lymphoblastic leukemia cell lines NALM-6 and REH were lentivirally transduced with plasmid expressing Cas9 nuclease (LentiCRISPR V2; Addgene Plasmid #52961) as described below at a MOI of 0.5 ...
-
bioRxiv - Microbiology 2021Quote: Cells stably expressing shRNA of different genes under the control of a tetracycline-inducible promoter were created by first transducing SNB-19 cells with lentivirus particles containing pLenti CMV TetR BLAST (Addgene; number 17492). The cells underwent selection with media containing 10 μg/mL of blasticidin (Invivogen ...
-
bioRxiv - Cell Biology 2019Quote: ... YFP-NuMA and mEmerald-IFT88 LLC-PK1 cells were generated by transfection of LLC-PK1 with pEYFP-C1-NuMA (Addgene plasmid #28238) or mEmerald-IFT88-N-18 (Addgene plasmid #54125) ...
-
bioRxiv - Cell Biology 2019Quote: Constructs used to rescue SHP2 knockout U2OS cells were obtained by cloning the SHP2 cDNA from pCMV-SHP2-WT (Addgene plasmid # 8381) into the migR1-IRES-GFP vector (Addgene plasmid # 27490) ...
-
A Novel PHOX/CD38/MCOLN1/TFEB Axis Important For Macrophage Activation During Bacterial PhagocytosisbioRxiv - Immunology 2019Quote: ... iBMDM GFP-TFEB stably transfected cells were created using pEGFP-N1-TFEB (pEGFP-N1-TFEB was a gift from Shawn Ferguson, Addgene plasmid # 38119), Lipofectamine 3000 (Thermo Fisher ...
-
bioRxiv - Genomics 2021Quote: ... Lentivirus production was carried out by co-transfecting HEK293T cells with 12.5 μg of Cas9 plasmid with blasticidin resistance (Addgene, cat. no. 52962), 7.5 μg psPAX2 plasmid and 4 μg the packaging pVsVg plasmids ...