Labshake search
Citations for Addgene :
1701 - 1750 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The TRIPZ plasmid was transfected into 293T cells along with lentiviral packaging and envelope 2nd generation plasmids (Addgene packaging 11263 ...
-
bioRxiv - Cell Biology 2021Quote: MEF cell lines were transduced with lentivirus containing Cas9 and guide RNA in the lentiCRISPRv2 plasmid (Addgene, 52961) and selected using 2 μg/ml puromycin ...
-
bioRxiv - Immunology 2021Quote: ... Cells were co-transfected with either plasmid #166856 or #166857 and a plasmid encoding BirA ligase (Addgene #32408) at a 4:1 ratio (m/m) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells expressing endogenous GFP-CLIC4 were transfected with Cry2-VHH Addgene #58370) and Tom20-CIB-stop (Addgene #117243). Cells were kept in the dark and incubated for 24-48 hours ...
-
bioRxiv - Genetics 2020Quote: ... Cas9 activity was assessed by transducing parental Vero-E6 or Vero-E6-Cas9 cells with pXPR_047 (Addgene 107645), which expresses eGFP and an sgRNA targeting eGFP (72) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or CALU6 and H1975 cells were infected with a metabolism focused CRISPR library (Addgene,(Birsoy et al., 2015)) ensuring a multiplicity of infection ∼0.3 following 3 days puromycin selection ...
-
bioRxiv - Developmental Biology 2022Quote: Lentiviruses were produced in HEK 293T cells by cotransfection of lentiviral constructs with third generation packaging plasmids (Addgene) for 48–72 hr ...
-
bioRxiv - Cell Biology 2022Quote: ... YAP–HaloTag CRISPR knock-in U-2 OS cells were transfected with pEGFP-C3-Lats1 (Addgene plasmid # 19053) or pEGFP C3-Mst2 (Addgene plasmid # 19056) ...
-
bioRxiv - Microbiology 2022Quote: ... HEK293T cells were used to package lentiviruses by co-transfecting viral packaging plasmids pCMV-VSV-G (Addgene #8454), psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which had been produced in HEK293T cells by transiently co-transfecting the lentiviral packaging plasmid psPAX2 (Addgene #12260), a lentiviral vector encoding μ-OR-SmBiT (pLenti-Blast Addgene #17451) ...
-
bioRxiv - Microbiology 2023Quote: The drug selection cassettes in the CN cell line were excised using transient expression of Cre recombinase from pLEW100Cre_del_tetO (Addgene plasmid 24019 ...
-
bioRxiv - Molecular Biology 2023Quote: ... MEFs cells were infected with a pLKO.1-Puro plasmid encoding a scrambled shRNA sequence (Addgene plasmid #1864). A list of the shRNA sequences is provided in Supplementary Table 2.
-
bioRxiv - Neuroscience 2022Quote: ... Lentivirus was created from this plasmid by co-transfecting HEK293T cells with this plasmid alongside psPAX2 (Addgene #12260) and MD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2022Quote: ... HEK293T WT cells were transfected using Lipofectamine3000 with pLenti plasmids and lentiviral packaging plasmids (Gag-pol (Addgene #14887), VSV-G (Addgene #8454) ...
-
bioRxiv - Neuroscience 2022Quote: ... Lipofectamine3000 was used to transfect cells with 0.5ug of pSpCas9(BB)-2A-GFP(PX458) targeting plasmid (Addgene # 48138) containing sgRNA sequences targeting full-length or truncations in SRRM2 and PNN (Supplemental Table 3) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthetic cell type specific promoters were obtained from the following Addgene plasmids: 161_pAAV-ProD5-CatCh-GFP-WPRE (Addgene plasmid # 125981 ...
-
bioRxiv - Genomics 2022Quote: Twenty million cell batches of J1 ESCs were transfected each with 20 μg dCas9-VPR vector (Addgene #63798) and 20 μg plasmid constructed by the IGBMC molecular biology platform (available on request) ...
-
bioRxiv - Immunology 2023Quote: ... CHD4 KO cells was similarly transfected with piggy bac plasmid encoding dCas9-KRAB-MeCP2 (45) (Addgene plasmid #110821) and selected with 10 µg/ml blasticidin for 1week then infected with lentiviruses expressing different guide RNAs under U6 promoter.
-
bioRxiv - Cancer Biology 2023Quote: ... we transfected Cos7 cells with Cx43-GFP (gift from David Spray (Addgene plasmid #69007; http://n2t.net/addgene:69007;RRID:Addgene_69007) (95) ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS-Cas9 and U2OSp53KO-Cas9 cells were generated using viral transduction of the lentiCas9-Blast plasmid (Addgene, #52962), followed by a 5-day selection with 5 µg/mL blasticidin ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lung KP cells stably expressing a hypoxia reporter (pLenti-5XHRE-GFP, Addgene #128958, denoted here as HRE-GFP), cell membrane marker (pLenti-mCherry-CAAX ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RBL-2H3 cells were transfected with the mitochondrial calcium indicator pCMV CEPIA2mt (a gift from Masamitsu Iino; Addgene plasmid # 58218 ...
-
bioRxiv - Genetics 2023Quote: ... 293T cells were transfected with 7.5 μg of of the plasmid pCMVR8.74 (a gift from Didier Trono (Addgene plasmid #22036 ...
-
bioRxiv - Molecular Biology 2023Quote: XEN cells were infected with lentiviruses harboring the pHR–SFFV–dCas9–BFP–KRAB vector (Addgene, cat. no. 46911), while ESC v6,5 cells were infected with a modified version of the plasmid in which the SFFV promoter was replaced with an Ef1a promoter 42 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by co-transfection of HEK293 cells with viral vector and packaging plasmids psPAX2 (Addgene 12260) and pMD2.G (Addgene 12259 ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviruses were generated by transfection of 293T cells with the indicated expression plasmid and the psPAX2 (Addgene 12260) and pVSVG (Addgene 14888 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were transfected with the plasmid pcDNA3_erGAP2 (a gift from Teresa Alonso and Javier García-Sancho, Addgene #78120), which encodes a low affinity fluorescent calcium biosensor ...
-
bioRxiv - Microbiology 2023Quote: Lentiviral vector stocks were obtained by transfection of 6.5 x 106 HEK293T cells with packaging vector gag-pol-rev (pCMV-dR8.74, #22036, Addgene), a vesicular stomatitis virus G (VSV-G ...
-
bioRxiv - Genomics 2023Quote: AAV production was performed by transfecting 293FT cells with 22 ug of pDGM6 helper plasmid (Addgene plasmid # 110660), 6 ug of donor template plasmid ...
-
bioRxiv - Synthetic Biology 2023Quote: Reporter plasmid was co-transformed with accessory and selection plasmids of interest into electrocompetent S1030 cells (Addgene #105063) and recovered using Davis rich media60 (DRM) ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-HEK 293T cells were generated using the CRISPR/Cas9 system from Addgene (http://www.addgene.org/). The sequences for guide RNAs were obtained from http://tools.genome-engineering.org and https://www.addgene.org/pooled-library/zhang-human-gecko-v2/ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transfected using 30 μg of pMSCV-loxP-dsRed-loxP-eGFP-Puro-WPRE plasmid (Addgene, Plasmid #32702) or pMSCV-loxP-dsRed-loxP-Cited2-3HA-Puro-WPRE plasmid (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: KEAP1-sg1 knockout H1299 (4 x 105) cells were transfected with or without plasmid expressing Halo-KEAP1 (Addgene, a gift from Yimon Aye ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was produced in 293 cells by co-transfecting the lentiviral constructs with pCMV-dR8.2 (Addgene plasmid #8455) and pCMV-VSV-G (Addgene plasmid #8454 ...
-
bioRxiv - Immunology 2023Quote: ... DC 2.4 cells were transduced using the lentiCas9-Blast vector (Addgene plasmid # 52962; http://n2t.net/addgene:52962; RRID: Addgene_52962) and selected with 10 ug/mL of Blasticidin (AG Scientific #3513-03-9) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... HEK293T cells were co-transfected with lenti-EF1a-dCas9-KRAB-Puro plasmid (a gift from Kristen Brennand; Addgene_99372) or pLV-dCas9-p300-P2A-PuroR plasmid (a gift from Charles Gersbach ...
-
bioRxiv - Microbiology 2023Quote: ... we rescued lentiviral particles by co-transfecting 293T cells with the MKRN2 lentiviral vector alongside d8.74 (Addgene; 22036) and MD2G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... MEF cells were transiently transfected with DRP1 K38A (gift from Alexander van der Bliek & Richard Youle55, Addgene, 45161) using Metafectene Pro (Biontex ...
-
bioRxiv - Biophysics 2023Quote: ... 37] was used to generate the α-catenin DVBS in α-catenin KO cell line (Addgene plasmid 178649).
-
bioRxiv - Microbiology 2023Quote: ... Lentiviral particles were harvested from supernatants of HEK293T cells that had been co-transfected with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259) ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF7 CRISPRi were prepared by transduction of MCF7 cells with lentiviral particles produced using vector pMH0001 (Addgene #85969) in the presence of 8 mg/mL polybrene (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF7 cells were first transduced with lentiviral particles produced using vector pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP (Addgene #60903) in the presence of 8 mg/mL polybrene ...
-
bioRxiv - Cell Biology 2023Quote: ... reporter cells were transduced with pMH0007-UCOE-pEF1ɑ-Cas9-HA-2xNLS-BFP (Addgene #174162, (Hein and Weissman, 2021)) ...
-
bioRxiv - Cell Biology 2023Quote: ... in HEK 293T cells (ATCC, VA) using 3rd generation lentiviral packaging plasmids pMDLg/pRRE (Addgene Inc., Plasmid 12251) and pRSV-RV (Addgene Inc. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ifngr2−/− and Etv4−/− KPAR cell lines were generated by transient transfection of a Cas9-sgRNA plasmid (pX459, Addgene) generated by standard molecular cloning techniques (see Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid encoding NPM1-mEGFP was a gift from the Allen Institute for Cell Science (Addgene plasmid # 109122). The sgRNA was synthesized by Synthego with modifications using the protospacer sequence UCCAGGCUAUUCAAGAUCUC (Wienert ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK-293T cells seeded into 12 well plates were transfected with the retroviral packaging plasmid pUMVC (Addgene: 8449), pLXIN (Clontech ...
-
bioRxiv - Bioengineering 2023Quote: ... Lentiviruses were packaged using 293FT cells by co-transfection of lentiviral transfer plasmids with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260 ...