Labshake search
Citations for Addgene :
1551 - 1600 of 2354 citations for Primary Human Aortic Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 2014) was co-transfected into 293FT cells with the lentiviral packaging plasmids psPAX2 and pMD2.G (Addgene). Viral production was accomplished as described previously (Joung et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were transduced with floxed jGCaMP7b (AAV1-syn-FLEX-jGCaMP7b-WPRE; Addgene #104493, MOI = 5×105 vg) [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH ...
-
bioRxiv - Cell Biology 2022Quote: Lentivirus stocks were produced in Hek293T cells using pCMVΔR8.91 as packaging plasmid and pMD2.G (Addgene #12259) as vesicular stomatitis virus G glycoprotein (VSV-G ...
-
bioRxiv - Microbiology 2022Quote: ... Early passage HEK293T cells were transfected with 1.5 μg of dCas9-KRAB-MeCP2 repressor plasmid (Addgene #110824) and 0.5 μg of Piggyback Transposase (gift from Maxim Greenberg) ...
-
bioRxiv - Microbiology 2022Quote: Hela-H1 cells were transfected with a plasmid encoding the VSV-G gene (pMD2.G; Addgene #12259) using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviruses were transfected into HEK293T cells in combination with viral packing and envelope plasmids pSPAX (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Biophysics 2022Quote: ... cells constitutively expressing CheRiff were transiently transfected with pCAG-Kir2.1-T2A-tdTomato (from Massimo Scanziani, Addgene 60598) using CalFectin transfection reagent (SignaGen Laboratories ...
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...
-
bioRxiv - Molecular Biology 2020Quote: ... For generation of the RPE-1-H2B-mEGFP-FKBP stable cell line the H2B-mEGFP (Addgene #105528) and FKBP (Promega N201A ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 106 HEK293T cells were transfected using GenJet transfection reagent (Signagen) with 7.5 µg psPax2 (Addgene #12260), 5 µg VSV-G (pMD2.G ...
-
bioRxiv - Developmental Biology 2022Quote: NPC-iPS cells (clone 16-13(Maetzel et al., 2014)) were targeted with AAVS1-tdTomato (Addgene 159275) as described before(Ma et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... the transfer plasmid was co-transfected into HEK-293T cells with the packaging plasmids pVSVg (Addgene, #8454) and psPAX2 (Addgene ...
-
Simplified Methodology for a Modular and Genetically Expanded Protein Synthesis in Cell-Free SystemsbioRxiv - Synthetic Biology 2019Quote: The bacterial strain used for the preparation of all cell extracts is the C321ΔprfA strain (Addgene #48998) carrying a pEVOL plasmid ...
-
bioRxiv - Developmental Biology 2019Quote: SAM mouse embryonic stem cells (ESCs) were generated by lentiviral transduction of lenti dCas9-VP64_Blast (Addgene 61425) and lenti MS2-p65-HSF1_Hygro (Addgene 61426 ...
-
bioRxiv - Genetics 2019Quote: ... HEK293T cells were transfected with a mixture of 100 ng of plasmid encoding sgRNA (pRG2; Addgene #104174) and 100 ng of plasmid encoding SpCas9 (pRGEN-Cas9-CMV/T7-Puro-RFP ...
-
bioRxiv - Genetics 2019Quote: ... To generate stable 786-O-dCas9-KRAB expressing cell line the Lenti-dCas9-KRAB-blast (Addgene #89567) was used ...
-
bioRxiv - Cell Biology 2019Quote: ... Lentivirus was packaged in 293FT or TN cells using the pMD2.G and psPAX2 helper plasmids (Addgene plasmids #12259 and #12260 ...
-
bioRxiv - Systems Biology 2019Quote: ... and Dnmt3L KI cells were transduced with the Mouse CRISPR Knockout Pooled Library (GeCKO v2) (Addgene, # 1000000052) [48] via spinfection as previously described ...
-
bioRxiv - Cancer Biology 2020Quote: CRISPR screen was performed in BT20 cells using the GeCKO v2 two vector system (Addgene, CAT# 1000000049). Both A and B libraries were amplified according to the distributor ...
-
bioRxiv - Molecular Biology 2020Quote: ... These cells were spin transfected for 2h at 1000g with 82*10E6 Brunello virus particles (LentiCRISPRv2, Addgene 73179-LV ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were transduced with lentiviral particles produced using vector pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS (Addgene #60904 ...
-
bioRxiv - Cancer Biology 2019Quote: ... A375 cells were first transduced with lentiviral particles produced using vector pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP (Addgene #60903 ...
-
bioRxiv - Microbiology 2020Quote: ... Lentiviral particles were generated by co-transfection of 293T cells with pLenti6-Dest_neo_ACE2-2A-Bla or pLenti6-Dest_Puro_TMPRSS2 together with pCMVR8.74 (Addgene plasmid 22036) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Microbiology 2019Quote: ... GM-CSF and IL-4 were produced from HEK293 cells transduced with pAIP-hGMCSF-co (Addgene #74168) or pAIP-hIL4-co (Addgene #74169) ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were reverse-transfected with 3 plasmids: psPAX2 (a gift from Didier Trono, Addgene #12260), pEGFP-Vpr (obtained through the NIH HIV Reagent Program ...
-
bioRxiv - Immunology 2021Quote: Generation of Scid.adh.2c2-dCas910x-GCN4 CRISPRi cells dCas910x-GCN4 (pHRdSV40-dCas9-10xGCN4_v4-P2A-BFP, Addgene #60904) was lentivirally transduced into Scid.adh.2c2 cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lenti- sgRNA/Cre vectors were individually co-transfected into 293T cells with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Cell Biology 2020Quote: ... 400,000 U2OS cells were transiently co-transfected with 200 ng gRNA expression plasmid (cloned into Addgene 43860), 500 ng Cas9 expression plasmid (Addgene 43945) ...
-
bioRxiv - Microbiology 2019Quote: ... These cytokine-conditioned media were produced from HEK293 cells stably transduced with pAIP-hGMCSFco (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
bioRxiv - Microbiology 2020Quote: ... lentiviruses were produced by co-transfecting HEK293T cells with a plasmid encoding VSV-G (Addgene cat#12259), a lentiviral Gag-Pol packaging plasmid (Addgene cat#8455) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RPE1-hTERT cells were co-transfected with either of these vectors and the hCas9 vector (Addgene #41815) using a Neon Transfection system (Thermo ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RPE1-hTERT TP53-/- RNF8-/- Cas9 cell line was generated by electroporation of phU6-gRNA (Addgene #53188) plasmids expressing sgRNAs (5’-CCCAGAGTCTAAATGGTGTT-3’ and 5’-GGAAGAGGAACAGCATCTTC-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... Lentivirus packaging was performed by using MaxPEI-based co-transfection of HEK293T cells with psPAX2 (Addgene #12260), pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected using Lipofectamine 2000 (Thermo) with the pSpCas9(BB)-2A-puro (px459) V2.0 plasmid (Addgene) containing CRISPR guide-RNAs (gRNAs ...
-
bioRxiv - Cancer Biology 2022Quote: ... 293T cells were transfected with retroviral or lentiviral transfer plasmid and packaging vector (retrovirus: pCL-Eco, Addgene, 12371 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus particles were packaged in 293T cells by co-transfecting carrier plasmids with psPAX (Addgene, plasmid 12260) and psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... melanoma cells were infected with a lentivirus made using pHAGE-PGK-GFP-IRES-LUC-W (Addgene # 46793) containing coding sequences for green-fluorescent protein and firefly luciferase ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were transfected with a lentiviral vector and the packaging plasmids pCMV-VSV-G (Addgene, 8454) and psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... USP10 KO cell lines: The selected sgRNA sequence (GCCTGGGTACTGGCAGTCGA) were cloned into Lenti-Cas9-puro vectors (Addgene). HEK293T or SW480 cells stably expressing Lenti-Cas9-puro sgUSP10 were generated following lentiviral infection and puromycin resistance selection ...
-
bioRxiv - Cell Biology 2022Quote: ... we co-transfected HEK293-FT cells with plasmids of interest with VSVG (pMD2.G; Addgene plasmid 12259) and psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Genomics 2022Quote: Knock-out cell lines were generated using the lentiCRISPRv2 CRISPR-Cas9 knock-out vector (Addgene no. 52961). Inducible knock-out cell lines were produced with the TLCV2 CRISPR-Cas9 backbone (Addgene no ...
-
bioRxiv - Immunology 2022Quote: ... cells were transduced with a lentiviral dCas9-HA-BFP-KRAB-NLS expression vector (Addgene plasmid no.102244).
-
bioRxiv - Genetics 2022Quote: Recombinant AAV-PHP.eB [13] was packaged in AAVpro 293T cells by co-transfection of PHP.eB (Addgene, 103005), pHelper (Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cells were transfected with 500 ng of CAG-Cas9-T2A-EGFP-ires-puro-plasmid (Addgene, #78311) and with 250 ng of gRNAs altogether using PEI transfection reagent with addition of 0.15 M NaCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... TCMC-OGFP cell line was generated by nucleofecting 1µg supercoiled Oct4-IRES-eGFP-PGK-Neo (Addgene #48681) plasmid to 1 million TCMC using P3 primary cell 4D-Nucelofector X kit (Lonza) ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Microbiology 2023Quote: Lentiviral particles for transduction were generated from 293T cells transfected with psPAX2 (Didier Trono, Addgene plasmid # 12260) and pMD.2 (Didier Trono ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells expressing DDX21-HA or OMP25-eGFP (expressed using pMXs-3XHA-EGFP-OMP25, Addgene: plasmid #83356) were cultured in 1x DMEM based media (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Cells were plated in 10-cm plates and transfected with plasmids expressing His6-SUMO1 (Addgene plasmid # 133770) or His6-SUMO2 (Addgene plasmid # 133771) ...