Labshake search
Citations for Addgene :
8551 - 8600 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: XEN cells were infected with lentiviruses harboring the pHR–SFFV–dCas9–BFP–KRAB vector (Addgene, cat. no. 46911), while ESC v6,5 cells were infected with a modified version of the plasmid in which the SFFV promoter was replaced with an Ef1a promoter 42 ...
-
bioRxiv - Molecular Biology 2023Quote: ... this plasmid was a gift from Noboru Mizushima (Addgene plasmid #84572, http://n2t.net/addgene:84572; RRID:Addgene_84572) (37) ...
-
bioRxiv - Molecular Biology 2023Quote: ... this plasmid was a gift from Noboru Mizushima (Addgene plasmid #84572 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pLKO-TRC plasmid was a gift from David Root (Addgene plasmid #10879 ...
-
bioRxiv - Systems Biology 2023Quote: ... We used the AsCas12a crRNA expression vector (pRG212, Addgene_149722) to clone the guide RNA (gRNA) ...
-
bioRxiv - Systems Biology 2023Quote: We obtained the AsCas12a crRNA expression vector directly from Addgene (pRG232, Addgene_149723)60 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... sgRNA-chimeras were modified from plasmid #61424 (Addgene). PCR was performed using Q5 High-Fidelity DNA polymerase from New England Biolabs (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: DNA plasmids encoding pENN-AAV-hSyn-Cre-hGH (#105553) and pAAV-CAG-H2B-GFP (#116869) were obtained from Addgene. AAV production was performed as previously described51 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected rAAV5-CAG-ArchT-tdTomato (UNC Vector Core AV4595B) or rAAV5-CAG-tdTomato (Addgene 59462) in the VPm (AP - 1.70 ...
-
bioRxiv - Plant Biology 2023Quote: ... or into the pAG416GPD-ccdB-HA vector (Alberti et al., 2007) (pAG416GPD-ccdB-HA was a gift from Susan Lindquist (Addgene plasmid # 14244 ...
-
bioRxiv - Pathology 2023Quote: Cre recombinase DNA was amplified by PCR using pCAG-Cre (Addgene #13775) as a template ...
-
bioRxiv - Synthetic Biology 2023Quote: ... flos-aquae were obtained from Addgene (#91696 and #106473). Oligos for molecular cloning were synthesized (Integrated DNA Technologies (IDT) ...
-
bioRxiv - Systems Biology 2023Quote: ... pcDNA3.1 mCit-His3C-GW as well as controls pcDNA3.1-NL-cmyc (Addgene plasmid ID #113442), pcDNA3.1-PA-mCit (Addgene plasmid ID #113443 ...
-
bioRxiv - Systems Biology 2023Quote: The donor and acceptor vectors pcDNA3.1-cmyc-NL-GW (Addgene plasmid ID #113446), pcDNA3.1-GW-NL-cmyc (Addgene plasmid ID #113447) ...
-
bioRxiv - Systems Biology 2023Quote: ... pcDNA3.1-PA-mCit (Addgene plasmid ID #113443) were kindly provided by the Wanker Group (Max-Delbrück-Centrum für Molekulare Medizin ...
-
bioRxiv - Systems Biology 2023Quote: ... pcDNA3.1-GW-NL-cmyc (Addgene plasmid ID #113447), pcDNA3.1 GW-His3C-mCit ...
-
bioRxiv - Systems Biology 2023Quote: ... HEK293T were transfected using polyethylenimine (PEI) with packaging constructs (pMDLg/pRRE, pRSV-Rev, pCMV-VSV-G, AddGene). Virus was harvested after 24h ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Biophysics 2023Quote: ... the StuI and XmaI restriction sites in plasmid pENTR4-HaloTag (Addgene #W876-1) were changed into a silent mutation following standard cloning techniques using primers TL-019-TL-020 and TL-023-TL-024 ...
-
bioRxiv - Biophysics 2023Quote: ... pyogenes dCas9 M1C D10A C80S H840A C574S (Addgene #60815) with 400 µM IPTG for 5 h at 20 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: The genes gabT and gabP were deleted from the EcN genome using the pSIJ8 plasmid (Jensen et al. 2016) containing the lambda Red recombineering system and ampicillin resistance (Addgene plasmid #68122). The plasmid was transformed into EcN via electroporation ...
-
bioRxiv - Synthetic Biology 2023Quote: ... al.14 The pCS2-mNG-C (the CMV mNG plasmid) was purchased from Addgene (plasmid #128144).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The vectors used for CRISPR/Cas9 were based on the pML104 vector (a gift from John Wyrick; Addgene plasmid # 676380), into which the guide sequences were introduced by site-directed mutagenesis ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... sourced from the pMitoLoc template vector (Addgene # 58980), was integrated into the pBSK(+)- Mpro(SAVLQ ...
-
bioRxiv - Pathology 2023Quote: ... 2 µg of pCA-mTmG plasmid (#26123, Addgene) was added to diluted TAT-Cre and incubated at 37°C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... 2007) (pAG416GPD-ccdB-HA was a gift from Susan Lindquist (Addgene plasmid # 14244; http://n2t.net/addgene:14244; RRID: Addgene_14244)) ...
-
bioRxiv - Plant Biology 2023Quote: ... These Level 0 promoter parts were used in in one-step digestion-ligation reactions with the Level 1 Loop pCk1 (Addgene #136695) backbones together with parts containing LucN (pEPYC0CM0133 ...
-
bioRxiv - Plant Biology 2023Quote: ... NJ) or amplified by PCR with overhangs containing SapI recognition sites and assembled into pUAP4 (Addgene #136079) to create parts compatible with the Phytobrick standard (74) ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Plant Biology 2023Quote: ... in a one-step restriction-ligation reactions with a double CaMV35s-ΩTMV promoter/5′ UTR (pICH51288; Addgene #50269), a C-terminal GR tag (pEPOZ0CM0137 ...
-
bioRxiv - Plant Biology 2023Quote: ... vectors encoding a nitrate-responsive green luciferase (AtNRPP-Eluc-Hsp18-2) and constitutively-expressed red luciferase (pNOS-Rluc-tNOS; pGREAT27, Addgene #170915) are delivered to root protoplasts ...
-
bioRxiv - Plant Biology 2023Quote: ... backbones together with parts containing LucN (pEPYC0CM0133, Addgene #154595), a C-terminal 3×FLAG® epitope tag (pICSL50007 ...
-
bioRxiv - Systems Biology 2023Quote: ... mCherry-LC3 and mNeon tagged N-terminally with the lipidation sequence of Lck (LckLip-mNeon, the original plasmid was a gift from Dorus Gadella (Addgene plasmid # 98821, (40)) ...
-
bioRxiv - Systems Biology 2023Quote: ... The Brunello library was a gift from David Root and John Doench (Addgene #73178) and amplified according to their protocol (33) ...
-
bioRxiv - Systems Biology 2023Quote: We then used the lentiCRISPRv2 plasmid (AddGene 52961) as a one vector system for co-delivery of the hSpCas9 protein and the sgRNA ...
-
bioRxiv - Systems Biology 2023Quote: Cells were first transformed with a plasmid expressing Cas9 (Addgene plasmid 43802) (Dicarlo et al ...
-
bioRxiv - Systems Biology 2023Quote: ... Tet-OFF constructs were designed from the original pCW57.1-MAT2A plasmid obtained by Addgene. The sequence from the end of the TRE-tight promoter to the beginning of the Blast resistance gene promoter was removed and replaced with each of the activating Notch ligand sequences fused to a T2A-H2B-mCherry sequence or with an H2B-mCherry or NGFR-T2A-H2B-mCherry sequence in the case of the control plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... forward and reverse primer pairs were annealed and then cloned into the BsmBI restriction site in the pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro vector (gift from C. Gersbach, Addgene #71236). HCT116 cell lines constitutively expressing dCas9-KRAB and appropriate targeting gRNA were generated as described in (Thakore et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... and inverted repeats were sub-cloned from Addgene plasmids #130637 ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids for type I-F CASTs Cascade over-expression were constructed by sub-cloning the individual genes into pRSFDuet1 (Addgene #126878) to create pIF1008 ...
-
bioRxiv - Microbiology 2023Quote: ... and the protospacer sequences were introduced in the Cas9-expressing pU6-Universal plasmid (Addgene, ref #52694) (75) ...
-
bioRxiv - Microbiology 2023Quote: ... and pRSV-Rev (Addgene plasmid#12253, RRID:Addgene_12253) were a gift from Didier Trono (86) ...
-
bioRxiv - Microbiology 2023Quote: ... and pRSV-Rev (Addgene plasmid#12253, RRID:Addgene_12253) were a gift from Didier Trono (86) ...
-
bioRxiv - Microbiology 2023Quote: ... pMDLg/pRRE (Addgene plasmid# 12251, RRID:Addgene_12251) and pRSV-Rev (Addgene plasmid#12253 ...
-
bioRxiv - Microbiology 2023Quote: pMD2.G (Addgene plasmid #12259, RRID:Addgene_12259), pMDLg/pRRE (Addgene plasmid# 12251 ...
-
bioRxiv - Microbiology 2023Quote: ... pAIP(Addgene plasmid #74171, RRID:Addgene_74171) was a gift from Jeremy Luban (87).
-
bioRxiv - Microbiology 2023Quote: ... pAIP(Addgene plasmid #74171, RRID:Addgene_74171) was a gift from Jeremy Luban (87).
-
bioRxiv - Molecular Biology 2023Quote: ... CAST V and inverted repeat constructs were sub-cloned from Addgene plasmids #127922 and #127924 to generate pIF1005 ...
-
bioRxiv - Genomics 2023Quote: ... and pCMV VSV-G (Addgene, plasmid #8454) lentiviral particles.
-
bioRxiv - Genomics 2023Quote: pLenti CMV GFP Puro (Addgene, plasmid #17448) plasmid was cut with BsrgI and SalI restriction enzymes ...