Labshake search
Citations for Addgene :
8501 - 8550 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... a pAAV-syn-ChR2-eYFP-Kv plasmid was purchased (RRID:Addgene_89256, originally from McLean Bolton), modified to insert a double-floxed inverse open reading frame (DIO ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli MG1655 K12 cells (Addgene #37854) transformed with reporter ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and GFP with a minimal promoter amplified from pMPRAv3:minP-GFP (Addgene plasmid #109036) using primers MPRA_v3_GFP_Fusion_F and MPRA_v3_GFP_Fusion_R was inserted by Gibson assembly resulting in the 200 bp oligo sequence positioned directly upstream of the promoter and the 20 bp barcode falling in the 3’ UTR of GFP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The oligonucleotide library was assembled into pMPRAv3:Δluc:ΔxbaI (Addgene plasmid #109035) and expanded by electroporation into E.coli ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Synthetic enhancers were amplified by PCR with primers that included homology to the plasmid vector E1b-GFP-Tol2 (Addgene plasmid #37845)81 and were cloned upstream of the minimal promoter (E1b ...
-
bioRxiv - Synthetic Biology 2023Quote: ... three fragments were cloned into the pUK21 backbone (Addgene #49787) which was digested using XhoI/XbaI to generate the intermediate plasmid pHA-white-dsRED ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a gift from Alejandro Chavez (Addgene plasmid # 160278; http://n2t.net/addgene:160278; RRID: Addgene 160278). In addition ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a gift from David Waugh (Addgene plasmid # 8827 ...
-
bioRxiv - Neuroscience 2023Quote: Stereotaxic intracranial injections with AAV-hSyn-ChR2-mCherry (Addgene, 26976) or AAV-hSyn-CHIEF-mRuby (courtesy of the Aoto Lab ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Vectors for arabinose memory (pAra) and the GFP reporter of recombinase activity (pRec1-OFF) were obtained from Addgene (40). In pAra ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Luciferase-pcDNA3 was a gift from William Kaelin (Addgene plasmid # 18964 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Luciferase-pcDNA3 was a gift from William Kaelin (Addgene plasmid # 18964 ; http://n2t.net/addgene:18964; RRID:Addgene_18964). The firefly luciferase from this plasmid was ligated into the pUdOm at SacI and XbaI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... The pEGFP-N1- hDEK plasmid (DEK WT sequence inserted into eGFP reporter plasmid “peGFP-N1”; Addgene 6085-1) was used as a template for mutagenesis PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were generated using the lentivirus Trono group second generation packaging system (Addgene) and selected using puromycin resistance (2 µg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: Reporter targeting vector was generated by altering HR180-LGR5-iCT plasmid (Addgene #129094) into a plasmid compatible with insertion of homology arms using golden-gate cloning56 ...
-
bioRxiv - Cell Biology 2023Quote: Whole-genome CRISPR screens were performed in U2OS and U2OSp53KO cells using the GeCKOv2 two-vector system (Addgene, #1000000049). The two pooled DNA half-libraries (A and B ...
-
bioRxiv - Cell Biology 2023Quote: ... Cloning was performed using the single-step digestion-ligation protocol from the Zhang lab (available on the Zhang lab Addgene page). To validate each guide ...
-
bioRxiv - Cell Biology 2023Quote: ... The synthesis protocol provided by the Church lab (available on Addgene) was followed to generate a plasmid with an sgRNA against p53 (5’GATCCACTCACAGTTTCCAT’3) ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene 54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS-Cas9 and U2OSp53KO-Cas9 cells were generated using viral transduction of the lentiCas9-Blast plasmid (Addgene, #52962), followed by a 5-day selection with 5 µg/mL blasticidin ...
-
bioRxiv - Cell Biology 2023Quote: ... This library was amplified according to the Zhang lab’s protocol (available on Addgene) and virus was generated using 293T cells ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967; http://n2t.net/addgene : 54967; RRID : Addgene 54967 [63]).
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells were transduced with virus containing lentiCas9-Blast (Addgene, #52962). Cells were then treated with 5 µg/mL blasticidin for 5 days to make a stable population of U2OS-Cas9 cells ...
-
bioRxiv - Cell Biology 2023Quote: The CRISPR HR oligo was generated by PCR using UPRT F and UPRT R primers and the 5’UPRT-pAPT1-APT1-Halo-3’UPRT plasmid as a template with Q5 high fidelity polymerase and 50ul of PCR reaction was cotransfected with 25 μg of pSag1::Cas9::U6::sgUPRT plasmid [45] (AddGene plasmid # 54467) into 1×107 TgMyoF-mAID parasites [39] ...
-
bioRxiv - Developmental Biology 2023Quote: zld, grh, or twi cDNA (isoforms RB, RH, and RA, respectively) were cloned into pMT-puro plasmid (Addgene) via Gibson cloning (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... The aqp1a.1 or aqp8a.1 cDNA was subcloned into pmCherry-N1 or pEGFP-N1 vector (Addgene). Human retinal microvascular endothelial cells (HRMECs ...
-
bioRxiv - Molecular Biology 2023Quote: pCMV_BE4max_P2A_GFP plasmid was a gift from David Liu (Addgene plasmid # 112094 ...
-
Ribosomal quality control factors inhibit repeat-associated non-AUG translation from GC-rich repeatsbioRxiv - Molecular Biology 2023Quote: ... the RPL22 sequence from the plasmid pLV-Ef1a-RPL22-3XHA-P2A-EGFP-T2A-Puro (gift from Hemali Phatnani, Addgene plasmid # 170317) was removed by restriction enzymes digestion with EcoRI-HF and AgeI-HF ...
-
bioRxiv - Molecular Biology 2023Quote: pCMV_BE4max_P2A_GFP plasmid was a gift from David Liu (Addgene plasmid # 112094; http://n2t.net/addgene:112094; RRID: Addgene_112094). Plasmids encoding sgRNA for HOXDeRNA rG4-1 base editing (5’CCATTCCCCTCGGAGCAGCT ...
-
bioRxiv - Molecular Biology 2023Quote: ... using pAAV-hSyn-DIO{ChETA-mRuby2}on-W3SL (Addgene #111389) as a backbone.
-
bioRxiv - Molecular Biology 2023Quote: ... Repeat sequences of (TTAGGG)23 and (TTACCG)23 were synthesized by GeneScript and subcloned into pHR-Tre3G-29×GGGGCC-12×MS2 (Addgene #99149) using Ligation high (TOYOBO) ...
-
bioRxiv - Microbiology 2023Quote: ... targeting the first exon of the human AHR gene (NM_001621) was cloned into BsmBI-digested Cas9 plasmid lentiCRISPR v2 (Addgene #52961). The resulting plasmid (pLentiCRISPRv2-sgAhR ...
-
bioRxiv - Microbiology 2023Quote: ... and pCAG D12L(ID:89161) and a Nelson Bay Virus syncytia inducing plasmid pCAG Fast p10 (ID:89152) were purchased from Addgene. pCI-S2 (T1L ...
-
bioRxiv - Molecular Biology 2023Quote: ... pET41b+_Npl4 (#117108) and pcDNA5/FRT/TO-FAF1-Strep-HA (#113486) were acquired from Addgene. Ubiquitin binding-deficient (*UBD ...
-
bioRxiv - Molecular Biology 2023Quote: ... were then infected with a lentivirus harboring the pLKO5.GRNA.EFS.PAC vector (Addgene, cat. no. 57825) containing either a single or 2 gRNAs targeting the region of interest ...
-
bioRxiv - Molecular Biology 2023Quote: ... Guides were inserted into a dCas9-KRAB-T2A-GFP lentiviral backbone containing both the gRNA under the U6 promoter and dCas9-KRAB-T2A-GFP under the Ubiquitin C promoter (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, a gift from Charles Gersbach, Addgene plasmid #71237) using annealed oligos and the BsmBI cloning site ...
-
bioRxiv - Microbiology 2023Quote: ... cells carrying pORTMAGE311B plasmid (Addgene no. 120418) were inoculated into 2 ml LB medium plus 50 μg/ml kanamycin and were grown at 37°C and continuous shaking (250 RPM ...
-
bioRxiv - Neuroscience 2023Quote: ... and was achieved using the pNrl-dsRed plasmid (Addgene #12764). Both constructs were purified at a concentration of ∼4ug/uL and were prepared as a 1:1 mixture for electroporation ...
-
bioRxiv - Neuroscience 2023Quote: ... we generated small guide RNAs to PAM sites in proximity to exons 4 and 7 of the murine Grik3 locus and cloned these into the pSpCas9(BB)-2A-GFP (PX458) backbone (Addgene #48138), where expression of the sgRNAs is controlled under the U6 promoter ...
-
bioRxiv - Plant Biology 2023Quote: The full-length or 3TPR-truncated cDNA sequence of SPY was amplified from Arabidopsis cDNA with appropriate primers (listed in Supplemental Table 1) and cloned into the pET28sumo vector (Addgene?), which adds a 6xHis-SUMO tag to the N-terminus of the protein of interest ...
-
bioRxiv - Neuroscience 2023Quote: ... were coated with 200 nL of a 1:1 mixture of 5% silk fibers and AAV9.CaMKII.GCaMP6f.WPRE.SV40 (Addgene viral prep # 100834-AAV9), as previously described by 70 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The amplicons were subsequently combined with a level 0 C-terminal 6xHis tag module pICSL50025 (Addgene plasmid # 174589) and either pOPARA1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pOPARA2 or pPGC-C (Addgene plasmid # 174580 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The kanMX cassette was obtained from the pCAS plasmid (Addgene, #60847) by PCR using PAB1_KanMX_F and PAB1_KanMX_R primers ...
-
bioRxiv - Molecular Biology 2023Quote: 1.6 x 108 A375 cells were transduced into thirty-two 150 mm plates with lentivirus carrying The Toronto Knockout Library v3 (TKOv3, Addgene # 90294) in standard culture media + 8 µg/mL polybrene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Feng Zhang (Addgene plasmid #62988; http://n2t.net/addgene:62988; RRID:Addgene_62988)28 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Feng Zhang (Addgene plasmid #62988 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pcDNA3-FLAG-DDB1 was obtained from Addgene (#19918). SR-4835 was purchased from MedChemExpress and CU-0904 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Due to the Purmocyin resistance the XEN-dCas9-BFP-KRAB cells were infected with a modified version of the pLKO5.GRNA.EFS.PAC vector (Addgene, cat. no. 57825) replacing puromycin with blasticidin resistance ...