Labshake search
Citations for Addgene :
8301 - 8350 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and pMD2.G (Addgene #12259), were transfected into HEK293T cells in the ratio of 4:3:1 ...
-
bioRxiv - Cell Biology 2023Quote: ... together with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Cell Biology 2023Quote: ... Kunieda Takekazu (Addgene plasmid #90019; http://n2t.net/addgene.90019; RRID: Addgene_90019). Empty vector (same plasmid without Dsup ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366 ...
-
bioRxiv - Cell Biology 2023Quote: ... plasmids pCDNA3.1(+)-CMV-βarrestin2-TEV (Addgene plasmid #107245 ...
-
bioRxiv - Genomics 2023Quote: The pZT-C13-L1 and pZT-C13-R1 constructs encoding the left and right TALENs specific to the CLYBL safe-harbor locus were a gift from Jizhong Zou (Addgene plasmid #62196 and #62197 ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentiviral packaging plasmids pMD2.G and psPAX2 (Didier Trono; 12259, 12260) were obtained from Addgene (Cambridge, MA). Four 15-cm culture plates containing HEK293T cells at 80% confluency were each transfected with 8 μg pTRIPZ-OGT-FH ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA candidates were cloned into the pX330 plasmid (Addgene, Feng Zhang; 42230) according to the published protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The pCAG-EGxxFP plasmid (Addgene, Masahito Ikawa; 50716) was cut with BamHI and SalI ...
-
bioRxiv - Cell Biology 2023Quote: This guide sequence was cloned into pSPCas9(BB)-2A-puro(PX459)V2.0 (Addgene, #62988) as described previously [83] to create pSPCas9(BB)-2A-puro(PX459)-hMyo10 ...
-
bioRxiv - Cell Biology 2023Quote: ... to generate viral supernatants for pLenti-EB1-EGFP (Addgene, #118084), pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332) ...
-
bioRxiv - Cell Biology 2023Quote: ... and the insert encoding AcGFP that was isolated from pAc-GFP-Sec61beta (from Tom Rapoport, Addgene #15108) restricted with BglII ...
-
bioRxiv - Cell Biology 2023Quote: ... pSFG-TFII-I-GFP delta and pSFG-TFII-I-GFP Y248&249F were obtained from Addgene(#22199, #22190, #22196).
-
bioRxiv - Cell Biology 2023Quote: ... The pcDNA3.1 mycBioID was a gift from Kyle Roux (Addgene plasmid # 35700; http://n2t.net/addgene:35700; RRID:Addgene_35700) and the pcDNA3.1 MCS-BirA(R118G)-HA was a gift from Kyle Roux (Addgene plasmid # 36047 ...
-
bioRxiv - Cell Biology 2023Quote: ... were maintained in DMEM supplemented with 10% FBS and 1x penicillin/streptomycin were used to produce lentiviral particles with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Cell Biology 2023Quote: ... the coding sequence was inserted into pBID-UASC-GRM (RRID:Addgene_35203, (Wang et al., 2012)) ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366; http://n2t.net/addgene:71366; RRID:Addgene_71366) (Han et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... These guides sequences were inserted into pSpCas9(BB)-2A-GFP (Addgene, #48138) to create pSpCas9(BB)-2A-GFP-ghMyo10 as described previously [83] ...
-
bioRxiv - Cell Biology 2023Quote: ... pLentiPGK DEST H2B-iRFP670 (Addgene, 90237), pLV-RFP-H2B (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... These plasmids were co-transfected with psPAX2 and pMD2.G (Addgene, #12259) into HEK-293T cells at ∼80% confluency using LipoD293 (SignaGen ...
-
bioRxiv - Cell Biology 2023Quote: ... pLV-RFP-H2B (Addgene, 26001), and pLenti-EGFP-Cre (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: We used the second generation lentiviral packaging plasmid psPAX2 (Addgene, #12260) to generate viral supernatants for pLenti-EB1-EGFP (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were transfected with the SMO-expressing plasmid (pGEN_mSMO, Addgene #3767329) in OptiMEM medium using FuGENE® HD transfection reagent (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: The constructs for epigenome editing were based on the plasmid pSpCas9n(BB)-2A-GFP (Addgene #48140) (Ran et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sense and antisense riboprobes were designed by subcloning fragments of coding cDNA sequences in pBlueScript II (SK or KS) plasmids (Addgene). Riboprobes were generated by in vitro transcription using the SP6/T7 DIG RNA labelling kit (Roche ...
-
bioRxiv - Bioengineering 2023Quote: ... miR-92a (Addgene #46672), let-7a (Addgene #51377 ...
-
bioRxiv - Bioengineering 2023Quote: ... containing the primary or a fragment of the primary miR sequences were obtained from Addgene as stab cultures ...
-
bioRxiv - Bioengineering 2023Quote: ... let-7a (Addgene #51377) using the Nucleofector V kit (Lonza ...
-
bioRxiv - Bioengineering 2023Quote: ... viral envelope (pMD2.G was a gift from Didier Trono; Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259). At 48 and 72 h post transfection ...
-
bioRxiv - Bioengineering 2023Quote: ... 1.5 μg psPAX2 (Addgene #12260) and 0.5 μg of the target-mCherry reporter transfer vector were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... The TALENs were cloned into an RCIscript-GoldyTALEN vector (Addgene). TALEN mRNAs were in vitro transcribed from SacI-linearized expression plasmids with T3 RNA polymerase using a mMessage mMachine mRNA kit (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... and sgRNAs and Cas9 were expressed from lentiCRISPR v2 (Addgene 52961). Virus was generated in HEK293T cells by transfection with the aforementioned transfer vectors and pMDLg (Addgene 12251) ...
-
bioRxiv - Cell Biology 2023Quote: ... Unique sgRNAs were cloned into the Cas9 guide plasmid pDD122 (Addgene, #47550). Following sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... The cDNAs of P4M (plasmid #51472) (Hammond et al., 2014) and PLCδ-PH domain (plasmid #21179) (Stauffer et al., 1998) were obtained from Addgene. The tRFP cDNA was a gift from Hideki Shibata (Nagoya University ...
-
bioRxiv - Cell Biology 2023Quote: ... was derived from PX459 V2.0 (Addgene plasmid #62988) by removing the human U6 promoter and the gRNA scaffold from it ...
-
bioRxiv - Cell Biology 2023Quote: pCP (expression plasmid of the puromycin-resistant gene and Cas9, Addgene plasmid #204743) was derived from PX459 V2.0 (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2023Quote: ... which involved the co-transfection of the plasmid containing the CDC50A target sequences and the Cas9 gene with a donor plasmid (pDonor-tBFP-NLS-Neo; Addgene plasmid #80766) referred to as Donor ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... They were inserted into the lentiCRISPRv2-puro vector (Addgene 52961) using the BsmBI restriction site ...
-
bioRxiv - Cell Biology 2023Quote: ... sabaeus genome and cloned into pSpCas9(BB)-2A-Puro (a gift from Feng Zhang, Addgene # 62988) following the protocol in [68] ...
-
bioRxiv - Cell Biology 2023Quote: ... target sequences are underlined) were synthesized and introduced into the BbsI-digested vector PX459 (Addgene plasmid #48139). To edit the CDC50A gene ...
-
bioRxiv - Cell Biology 2023Quote: ... digested px459 vectors (Addgene; 62988) 92 ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pTet-O-Ngn2-puro was a kind gift from Marius Wernig (Addgene plasmid #52047 ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pTet-O-Ngn2-puro was a kind gift from Marius Wernig (Addgene plasmid #52047; http://n2t.net/addgene:52047; RRID: Addgene_52047). The Ngn2 gene cassette was excised using the restriction enzymes EcoRI and XbaI ...
-
bioRxiv - Developmental Biology 2023Quote: ... restriction site in the plasmid pU6-(BbsI)_CBh-Cas9-T2A-BFP (Addgene). The protocols for gRNA cloning and transformation of competent E ...
-
bioRxiv - Developmental Biology 2023Quote: ... and GFPmRNA was made using pCAG-GFP (Addgene Cat# 11150).
-
bioRxiv - Developmental Biology 2023Quote: Cre mRNA was created using pCAG-Cre plasmid (Addgene Catalog number #13775), mCherry mRNA was created using (Addgene pX330-U6-Chimeric_BB-CBh-hSpCas9 Cat# 42230 ...
-
bioRxiv - Developmental Biology 2023Quote: ... pCAGEN-Ntn4 expression plasmid was constructed by cloning the full-length coding sequence out of mouse Ntn4-AP-His plasmid (Addgene 71980) using the primers in Table 1 ...