Labshake search
Citations for Addgene :
8251 - 8300 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and pCXLE-hUL (Addgene: 27080) (kind gift from Shinya Yamanaka) ...
-
bioRxiv - Cancer Biology 2023Quote: The short guide sequences (gDusp6-3C-Forward: caccGACGACTCGTATAGCTCCTG; gDusp6-3C-Reverse: aaacCAGGAGCTATACGAGTCGTC) were cloned into pSpCas9(BB)-2A-GFP (PX458) (Addgene) following the Sequence Cloning Protocol from Zhang Lab (https://www.addgene.org/crispr/zhang/) ...
-
bioRxiv - Cancer Biology 2023Quote: ... self-complementary single-stranded DNA oligos (Supp Table S2) were annealed and cloned into AgeI/EcoR1 sites of Tet-pLKO-puro vector (Addgene plasmid # 21915). All constructs were validated by direct sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... pcDNA3_nucGAp (a gift from Teresa Alonso, Addgene #78736) was used to assess nuclear Ca2+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... using pLenti_mENPP1_fwd and pLenti_mENPP1_rev primers in Table S1 and inserted into the XbaI-BamHI sites of pLenti-CMV-GFP-Puro (Addgene). To clone pLenti-CMV-mENPP1-T238A-GFP-Puro plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Histone H2B-mCherry was purchased from Addgene (#20972 (Nam and Benezra, 2009)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... by cloning annealed oligonucleotides containing the targeting sequence (Table S4) into the pSpCas9(BB)-2A-Puro vector (a gift from Feng Zhang, Addgene plasmid # 48139) (Ran et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... mCherry-VIRHD and pLenti-puro-LacZ (a gift from Ie Ming Shih, Addgene plasmid # 39477) (Guan et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sgRNA oligos targeting the different genomic regions of HOTAIR gene were synthesized and cloned into the BbsI site of PX548 (Addgene, Cat. No: 48138) construct following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells expressing DDX21-HA or OMP25-eGFP (expressed using pMXs-3XHA-EGFP-OMP25, Addgene: plasmid #83356) were cultured in 1x DMEM based media (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... OMM-jRCaMP1b (Plasmid #127871) and GFP-LC3 (Plasmid #22405) were purchased from Addgene, transfected to the cells for the indication of mitoCa2+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 µg pMD2.G (#12259, Addgene) plasmids by using lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% Pen/Strep and 0,5mg/ml Geneticin) by transient transfection of transfer vector 2nd generation packaging plasmid-psPAX2 (Addgene #12259) and envelope vector-pMD2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... a gift from Eric Campeau and Paul Kaufman (Addgene plasmid # 17452;http://n2t.net/addgene:17452 ...
-
bioRxiv - Cancer Biology 2023Quote: pBABE-puro-gateway-ERBB2 was a gift from Matthew Meyerson (Addgene plasmid No. 40978; http://n2t.net/addgene:40978; RRID:Addgene_40978). ERBB3 wild-type was cloned from pBABE-puro-gateway-ERBB3 60 into pLenti CMV Puro DEST (w118-1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or DUSP6 (Addgene #27975) or control empty (Genecopoeia ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5X106 purified T cells were electroporated (program U-14) in presence of the pT4.iC9.79D vector and the transposase SB100X plasmid (Addgene 34879) or of the transposase SB100X mRNA ...
-
bioRxiv - Cancer Biology 2023Quote: SUDHL-4 cell line was infected using pLKO.1-puro-GFP U6 sgRNA (Addgene #50920) containing BAX RNA guides or non-targeting RNA guide:
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371; http://n2t.net/addgene:185371; RRID:Addgene_185371), MEK1-GFP was a gift from Rony Seger (Addgene plasmid # 14746 ...
-
bioRxiv - Cancer Biology 2023Quote: ... MEK1-GFP was a gift from Rony Seger (Addgene plasmid # 14746 ...
-
bioRxiv - Cancer Biology 2023Quote: ... MEK1-GFP was a gift from Rony Seger (Addgene plasmid # 14746; http://n2t.net/addgene:14746; RRID:Addgene_14746) pEF-MYC-RAF1 (gift from Walter Kolch) ...
-
bioRxiv - Cancer Biology 2023Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371 ...
-
bioRxiv - Biophysics 2023Quote: CB1-pcDNA3 was a gift from Mary Abood (Addgene plasmid # 13391; http://n2t.net/addgene:13391; RRID:Addgene_13391). L-YFP-GT46 was a gift from P ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Biophysics 2023Quote: ... The reporter plasmids were subcloned using the vector backbone of pGL410_INS421 which has a human insulin promotor regulating firefly luciferase expression (a gift from Kevin Ferreri Addgene plasmid #49057 ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Cell Biology 2023Quote: Plasmids pDEST-ORF-V1 and pDEST-ORF-V2 (Addgene plasmids #73637 and #73638) were a gift of Darren Saunders (The Kinghorn Cancer Institute ...
-
bioRxiv - Cell Biology 2023Quote: ... and pMD2.G (Addgene #12259) using PolyJet In Vitro DNA Transfection Reagent (SignaGen ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentiviral plasmids were co-transfected in HEK293T cells with PsPAX2 (Addgene#12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... 49 (Addgene, 20668) using electroporation ...
-
bioRxiv - Cell Biology 2023Quote: ... and pLenti-EGFP-Cre (Addgene, 86805). These plasmids were co-transfected with psPAX2 and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The hybridized double-stranded (ghCOL7A1-S + ghCOL7A1-A) DNA fragment cloned into the Esp3I (BsmBI) restriction sites of the LentiCRISPRv2GFP (Addgene plasmid # 82416) using a simultaneous digestion-ligation reaction as described previously (16) ...
-
bioRxiv - Cell Biology 2023Quote: ... was cloned with a N terminal Myc tag in pCMV3 vector from SinoBiological (Catalog no: Cat: CV011) and in pcDNA3-HA2-Keap1 and pCDNA3-Myc3-Nrf2 are gifts from Yue Xiong (Addgene plasmid # 21556 ...
-
bioRxiv - Cell Biology 2023Quote: ... Matrix-roGFP and cyto-roGFP was a gift from Paul Schumacker (Addgene plasmid # 49437 and Addgene plasmid # 49435 ...
-
bioRxiv - Cell Biology 2023Quote: ... Matrix-roGFP and cyto-roGFP was a gift from Paul Schumacker (Addgene plasmid # 49437 and Addgene plasmid # 49435) (Waypa et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... pLminP_Luc2P_RE4 was a gift from Ramnik Xavier (Addgene plasmid # 90338), (O’Connell et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... pBa-KIF5C 559-tdTomato-FKBP was a gift from Gary Banker (Addgene plasmid # 64211; http://n2t.net/addgene:64211; RRID: Addgene_64211). mCherry-β-actin ...
-
bioRxiv - Cell Biology 2023Quote: ... PaGFP-UtrCH was a gift from William Bement (Addgene plasmid # 26738; http://n2t.net/addgene:26738; RRID: Addgene_26738; 24). mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149 ...
-
bioRxiv - Cell Biology 2023Quote: ... mRuby2-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 55889; http://n2t.net/addgene:55889; RRID: Addgene_55889). PaGFP-UtrCH was a gift from William Bement (Addgene plasmid # 26738 ...
-
bioRxiv - Cell Biology 2023Quote: ... mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149 ...
-
bioRxiv - Cell Biology 2023Quote: ... mMaroon1 (pcDNA3.1-mMaroon1) plasmid was provided by Michael Lin (Addgene plasmid # 83840; http://n2t.net/addgene: 83840; RRID: Addgene_83840; 30). mRuby2-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 55889 ...
-
bioRxiv - Cell Biology 2023Quote: ... mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149; http://n2t.net/addgene:57149; RRID: Addgene_57149). pBa-KIF5C 559-tdTomato-FKBP was a gift from Gary Banker (Addgene plasmid # 64211 ...
-
bioRxiv - Cell Biology 2023Quote: ... PaGFP-UtrCH was a gift from William Bement (Addgene plasmid # 26738 ...
-
bioRxiv - Cell Biology 2023Quote: ... Kunieda Takekazu (Addgene plasmid #90019 ...
-
bioRxiv - Cell Biology 2023Quote: ... guide sequences were designed using CRISPOR tool61 and cloned into pSptCas9(BB)-2A-Puro(PX459)-V2.0 guide expression plasmid (Addgene #62988). The complete list of guide sequences can be found in Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... For mCherry labelling we replaced eGFP to mCherry from pTK96_mCherry-MRLC2 (Addgene #46358) vector using AgeI and BsrGI sites ...
-
bioRxiv - Cell Biology 2023Quote: ... we amplified the SERCA2b cDNA from Addgene plasmid #75188 using SERCA specific forward 5’-GGGAGATCTATGGAGAACGCGCACACCAAGACGG-3’ and reverse 5’-GGGGTCGACTCAAGACCAGAACATATCGCTAAAGTTAG-3’ primers with overhanging BglII and SalI sites for pEGFP-C1 vector insertion ...
-
bioRxiv - Cell Biology 2023Quote: ... FKBP12F36V (dTAG, Addgene #62988), MS2×128 array24 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transiently transfected with Cas9 and single guide RNAs plasmids with EGFP expression (PX458; Addgene plasmid no. 48138). The single guide RNAs targeting CDK6 and CDK4 (sequences TTAGATCGCGATGCACTACT and ATCTCGGTGAACGATGCAAT respectively ...