Labshake search
Citations for Addgene :
8051 - 8100 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Cancer Biology 2023Quote: ... The standard transfection mixture included 3 μg of total DNA [1.5 µg lentiviral plasmid + 1.5 µg helper plasmids - psPAX2 (RRID: Addgene_12260) and pMD2.G (RRID ...
-
bioRxiv - Cancer Biology 2023Quote: ... The CRISPR/Cas9 constructs to target SLC1A1 were based on sequences provided in the Gecko library and generated by annealing the appropriate sgRNAs (described in the Oligo list) and cloning them into BsmBI-digested pLentiCRISPRv2 plasmids (RRID: Addgene_52961).
-
bioRxiv - Cancer Biology 2023Quote: ... HOXB13 was PCR amplified from pLX302_HOXB13 (Addgene #70089), digested with SalI/XbaI and ligated into linearized pENTR1A (Addgene #17398) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shFF was cloned into pLKO.1-puro (Addgene #8453). For tet-inducible shRNA knock-down system ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pMD2.G (RRID: Addgene_12259) mixed in a 3:1 ratio] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Entry plasmids were recombined to the all-in-one Tet-inducible pLX402 (Addgene #25896) destination vector with Gateway LR Clonase II Enzyme Mix (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO_HOXB13_#1 (Addgene #70093) and pLKO_HOXB13_#2 (Addgene #70094 ...
-
bioRxiv - Cancer Biology 2023Quote: pLENTI CMV V5-Luc Blast vector (Addgene #19785) and lentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Expression constructs were generated by cloning the SLC1A1 mutant constructs into the pLX304 destination vector (RRID: Addgene_25890) using Gateway cloning (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293 cells were transfected with a mixture of the 3rd generation lentiviral packaging plasmids containing: 2 μg of Rev (pRSV-Rev, Addgene #12253), 2 μg of Gag and Pol (pMDLg/pRRE ...
-
bioRxiv - Biochemistry 2023Quote: ... we ligated the gel-purified fragments at the HindIII and BamH1 site and inserted into the HindIII and BamH1 digested linear pT7-CMVtrans-FFLuc-polyA vector (Addgene 101156). We confirmed positive clones for the full length of the insert by DNA sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... the strain was transformed with the TRP1-GAL1 cassette from pFA6-TRP1-PGAL1 (RRID:Addgene_41606, ref. (76)) ...
-
bioRxiv - Biochemistry 2023Quote: ... the plasmid pFA6-His3MX6-PGAL1-3HA (RRID:Addgene_41610, ref. (76)) was used to obtain the His3MX6-PGAL1-3HA cassette by PCR amplification (see Additional file 6 ...
-
bioRxiv - Biophysics 2023Quote: ... and envelope plasmid VSV-G (0.6 µg; Addgene #12259) were mixed with reduced-serum Minimal Essential Medium (Opti-MEM ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNA for expressing CRY2olig tagged with mCherry at its C-terminus was obtained from Addgene (#60032; Watertown, MA, USA). The plasmid (1.0 µg/dish ...
-
bioRxiv - Biophysics 2023Quote: ... The plasmid was given by the Michael Rosen group (Addgene plasmid #127093).
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfer lentiviral plasmids (2500 ng) were diluted in 200 µl serum-free medium together with 225 ng pCMV-VSV-G (Addgene #8454) and 2250 ng psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... digested with SalI/XbaI and ligated into linearized pENTR1A (Addgene #17398). Site-directed mutagenesis was performed to generate mutation constructs ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of Gag and Pol (pMDLg/pRRE, Addgene #12251), and 2 μg of VSV-G envelope expressing plasmid (pMD2.G ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 μg of VSV-G envelope expressing plasmid (pMD2.G, Addgene #12259), and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G ...
-
bioRxiv - Cancer Biology 2023Quote: ... which was a gift from Inder Verma (Addgene plasmid # 12371) For molecular analyses ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pRSV-Rev were gifts from Didier Trono (Addgene plasmid # 12251; http://n2t.net/addgene:12251 ; RRID:Addgene_12251) [26] ...
-
bioRxiv - Cancer Biology 2023Quote: ... pCDH-EF1-copGFP-T2A-Puro and pCDH-CMV-mCherry-T2A-Puro were gifts from Kazuhiro Oka (Addgene plasmid # 72263 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and an empty backbone plasmid (psPAX2; #12260, Addgene, USA) into HEK293T cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... LentiCRISPR v2 (Addgene #52961) plasmid DNA (2 µg ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was packaged by co-transfecting transfer plasmids with pMD2.G (Addgene #12259) and pCMV dR8.2 (Addgene #12263 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pCMV dR8.2 (Addgene #12263) to Lenti-XTM 293 cells (Takara Bio ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Paul Thomas (Addgene plasmid #100900, RRID:Addgene_100900). The FKBP-WRN donor plasmid construct and WRN targeting vector were verified using Sanger sequencing (ACGT DNA Sequencing Services).
-
bioRxiv - Cancer Biology 2023Quote: ... 53BP1-mCherry was excised mCherry-BP1-2 pLPC-Puro (Addgene plasmid #19835) (Dimitrova et al ...
-
bioRxiv - Cancer Biology 2023Quote: Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
bioRxiv - Cancer Biology 2023Quote: ... amplified from pAAVS1-NDi-CRISPRi (Gen1) (Addgene #73497) and cloned in via Pfl23II and MluI restriction sites for fluorescent-assisted cell sorting ...
-
bioRxiv - Cancer Biology 2023Quote: The puromycin resistance cassette in the original CROPseq-Guide-Puro vector (Addgene #86708) was replaced with a mCherry sequence ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were transfected with viral packaging plasmids psPAX2 Addgene #12260) and pMD2.G (Addgene#12259), and pLKO.1 shRNA using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pHAGE-PIK3CA-H1047L was a gift from Gordon Mills & Kenneth Scott (Addgene plasmid # 116499 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pHAGE-PIK3CA-H1047L was a gift from Gordon Mills & Kenneth Scott (Addgene plasmid # 116499; http://n2t.net/addgene:116499; RRID:Addgene_116499). pHAGE-AKT1-E17K was a gift from Gordon Mills & Kenneth Scott (Addgene plasmid # 116103).
-
bioRxiv - Cancer Biology 2023Quote: Lentivirus particles were produced in the packaging cell line HEK293T using packaging vectors psPAX2 and pMD2.G (both from Addgene). Plasmids were transfected with polyethyleneimine (PEI ...
-
bioRxiv - Cancer Biology 2023Quote: ... pHAGE-AKT1-E17K was a gift from Gordon Mills & Kenneth Scott (Addgene plasmid # 116103).
-
bioRxiv - Cell Biology 2023Quote: ... and pTriEx-mCherry-Zdk1 (Addgene plasmid # 81057) were a gift from Klaus Hahn32 ...
-
bioRxiv - Cell Biology 2023Quote: ... with either pEGFP_TRPM8 (#64879, Addgene, Watertown, MA) or pEGFP-C1 (Clonthech Laboratories ...
-
Identification of resistance mechanisms to small-molecule inhibition of TEAD-regulated transcriptionbioRxiv - Cancer Biology 2023Quote: ... and lenti-Cas9-2A-Blast (Addgene #73310) vectors were from Addgene ...
-
Identification of resistance mechanisms to small-molecule inhibition of TEAD-regulated transcriptionbioRxiv - Cancer Biology 2023Quote: ... vectors were from Addgene. Cells were virally transduced with lenti-Cas9-2A-Blast and selected with Blasticidin-S (3µg/ml ...
-
bioRxiv - Cancer Biology 2023Quote: ... The lines were generated by transduction of tet-inducible lentiviral vector for ORF expression (Addgene, pInducer 20, catalog # 44012). The ADA gene was cloned into the overexpression cell line and the 11th beta-strand of GFP was used as a doxycycline control (Dox-control).
-
bioRxiv - Cancer Biology 2023Quote: The Human Brunello v2 CRISPR KO pooled library (76,441 gRNAs, targeting 19,114 genes, including 1,000 controls) was bought from Addgene (Watertown, MA, USA, Addgene ID: 73179). Plasmid library were amplified by electro-transformation (Lucigen ...
-
bioRxiv - Cancer Biology 2023Quote: ... psPAX2 (Addgene 12260) and pVSVg (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pRSV-Rev were gifts from Didier Trono (Addgene plasmid # 12251 ...
-
bioRxiv - Cancer Biology 2023Quote: ... we obtained sgTP53_3 which was a gift from William Hahn (Addgene plasmid # 78164), and lentiCRISPRv2 hygro which was a gift from Brett Stringer (Addgene plasmid # 98291).