Labshake search
Citations for Addgene :
8001 - 8050 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... digested px459 vectors (Addgene; 62988) 92 ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pTet-O-Ngn2-puro was a kind gift from Marius Wernig (Addgene plasmid #52047 ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pTet-O-Ngn2-puro was a kind gift from Marius Wernig (Addgene plasmid #52047; http://n2t.net/addgene:52047; RRID: Addgene_52047). The Ngn2 gene cassette was excised using the restriction enzymes EcoRI and XbaI ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentiviral packaging plasmids pMD2.G and psPAX2 (Didier Trono; 12259, 12260) were obtained from Addgene (Cambridge, MA). Four 15-cm culture plates containing HEK293T cells at 80% confluency were each transfected with 8 μg pTRIPZ-OGT-FH ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA candidates were cloned into the pX330 plasmid (Addgene, Feng Zhang; 42230) according to the published protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... The pCAG-EGxxFP plasmid (Addgene, Masahito Ikawa; 50716) was cut with BamHI and SalI ...
-
bioRxiv - Cell Biology 2023Quote: This guide sequence was cloned into pSPCas9(BB)-2A-puro(PX459)V2.0 (Addgene, #62988) as described previously [83] to create pSPCas9(BB)-2A-puro(PX459)-hMyo10 ...
-
bioRxiv - Cell Biology 2023Quote: ... to generate viral supernatants for pLenti-EB1-EGFP (Addgene, #118084), pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332) ...
-
bioRxiv - Cell Biology 2023Quote: ... The pcDNA3.1 mycBioID was a gift from Kyle Roux (Addgene plasmid # 35700; http://n2t.net/addgene:35700; RRID:Addgene_35700) and the pcDNA3.1 MCS-BirA(R118G)-HA was a gift from Kyle Roux (Addgene plasmid # 36047 ...
-
bioRxiv - Cell Biology 2023Quote: ... were maintained in DMEM supplemented with 10% FBS and 1x penicillin/streptomycin were used to produce lentiviral particles with psPAX2 (Addgene 12260), pMD2.G (Addgene 12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... was derived from PX459 V2.0 (Addgene plasmid #62988) by removing the human U6 promoter and the gRNA scaffold from it ...
-
bioRxiv - Cell Biology 2023Quote: pCP (expression plasmid of the puromycin-resistant gene and Cas9, Addgene plasmid #204743) was derived from PX459 V2.0 (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2023Quote: ... which involved the co-transfection of the plasmid containing the CDC50A target sequences and the Cas9 gene with a donor plasmid (pDonor-tBFP-NLS-Neo; Addgene plasmid #80766) referred to as Donor ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transiently transfected with Cas9 and single guide RNAs plasmids with EGFP expression (PX458; Addgene plasmid no. 48138). The single guide RNAs targeting CDK6 and CDK4 (sequences TTAGATCGCGATGCACTACT and ATCTCGGTGAACGATGCAAT respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... and pMD2.G (Addgene #12259), were transfected into HEK293T cells in the ratio of 4:3:1 ...
-
bioRxiv - Cell Biology 2023Quote: ... together with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Cell Biology 2023Quote: ... Kunieda Takekazu (Addgene plasmid #90019; http://n2t.net/addgene.90019; RRID: Addgene_90019). Empty vector (same plasmid without Dsup ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366 ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366; http://n2t.net/addgene:71366; RRID:Addgene_71366) (Han et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... These guides sequences were inserted into pSpCas9(BB)-2A-GFP (Addgene, #48138) to create pSpCas9(BB)-2A-GFP-ghMyo10 as described previously [83] ...
-
bioRxiv - Cell Biology 2023Quote: ... pLentiPGK DEST H2B-iRFP670 (Addgene, 90237), pLV-RFP-H2B (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... These plasmids were co-transfected with psPAX2 and pMD2.G (Addgene, #12259) into HEK-293T cells at ∼80% confluency using LipoD293 (SignaGen ...
-
bioRxiv - Cell Biology 2023Quote: ... pLV-RFP-H2B (Addgene, 26001), and pLenti-EGFP-Cre (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: We used the second generation lentiviral packaging plasmid psPAX2 (Addgene, #12260) to generate viral supernatants for pLenti-EB1-EGFP (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Bioengineering 2023Quote: ... 1.5 μg psPAX2 (Addgene #12260) and 0.5 μg of the target-mCherry reporter transfer vector were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: The ST7 expression plasmid was synthesized by using the public sequence of the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (Addgene #42230)(Cong et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... nanopore reads were mapped to plasmids carrying SEPARATOR (1174D, Addgene as plasmid #200012) using minimap274 and further aligned them to the AaegL5.0 genome (GCF_002204515.2) ...
-
bioRxiv - Bioengineering 2023Quote: ... We ordered pairs of complementary forward and reverse single stranded oligonucleotides (IDT) for each guide containing compatible overhang sites for insertion into a lentiCRISPRv2-Puro (Addgene #98290) backbone ...
-
bioRxiv - Bioengineering 2023Quote: ... A plasmid encoding pDisplay-mSA (Addgene #39863) was generously provided by Dr ...
-
bioRxiv - Bioengineering 2023Quote: ... Fluorescent expressing C2C12s were created by introducing copGFP (pCDH-EF1-copGFP-T2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 72263; http://n2t.net/addgene:72263; RRID:Addgene_72263) and fluorescent HMEC1s were created by introducing mCherry (pCDH-CMV-mCherry-T2A-Puro was a gift from Kazuhiro Oka (Addgene plasmid # 72264 ...
-
bioRxiv - Biophysics 2023Quote: The coding sequences of Skylan-NS12 (Addgene, plasmid #86785) and LC3B were subcloned into the pMRX-IRES-puro vector and transduced into MEFs using retroviruses packaged in Plat-E cells ...
-
bioRxiv - Biophysics 2023Quote: ... with an N-terminal hexahistidine tag and T7 tag in pRSET plasmid was gift from was a gift from Yasushi Saeki (Addgene plasmid # 110313)46 ...
-
bioRxiv - Cancer Biology 2023Quote: ... obtained from Sigma were cloned into the pSpCas9(BB)-2A-GFP bacterial plasmid sourced from Addgene (PX458; RRID: Addgene_48138) following the protocol as defined by the Zhang lab [19] and sequenced for correct oligonucleotide insertion ...
-
bioRxiv - Cancer Biology 2023Quote: ... obtained from Sigma were cloned into the pSpCas9(BB)-2A-GFP bacterial plasmid sourced from Addgene (PX458; RRID: Addgene_48138) following the protocol as defined by the Zhang lab [19] and sequenced for correct oligonucleotide insertion ...
-
bioRxiv - Cancer Biology 2023Quote: ... or Lifr were generated by transducing cells with the plasmid lenticrispr V2 puro (Addgene #98290) cloned with a specific guide ...
-
bioRxiv - Cancer Biology 2023Quote: ... was engineered by first inserting NLS-mCherry (Gift from Ron Vale, Addgene 67932) and a pGK-driven neomycin resistance cassette into a 3rd generation vector backbone ...
-
bioRxiv - Cancer Biology 2023Quote: ... (Gift from Bruce Conklin, Addgene 31845)76,77 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by co-transfection of HEK293 cells with viral vector and packaging plasmids psPAX2 (Addgene 12260) and pMD2.G (Addgene 12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pMD2.G (Addgene 12259) using JetPrime transfection reagent (101000046) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The BRN2 reporter (pROM-POU3F2p-mCherry-Neo, Addgene 153321) was engineered by first inserting NLS-mCherry (Gift from Ron Vale ...
-
bioRxiv - Biophysics 2023Quote: ... The reporter plasmids were subcloned using the vector backbone of pGL410_INS421 which has a human insulin promotor regulating firefly luciferase expression (a gift from Kevin Ferreri Addgene plasmid #49057 ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Biophysics 2023Quote: CB1-pcDNA3 was a gift from Mary Abood (Addgene plasmid # 13391; http://n2t.net/addgene:13391; RRID:Addgene_13391). L-YFP-GT46 was a gift from P ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Cell Biology 2023Quote: ... embryos were electroporated at DIV0 just before plating with 3 µg of the plasmid control encoding for Td-tomato alone (pCAG td Tomato, Addgene) or 3 µg of plasmid encoding for Cre-recombinase and reporter gene Td-tomato (pCAG td Tomato-Ires-Cre ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were transfected with 1 μg of mCherry- Clathrin LC-15 (Addgene) to label clathrin-coated vesicles ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were transfected with EGFP-CAAX (Addgene) plasmid to mark the membrane ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate H2B-Cerulean, mCerulean (Rizzo et al., 2004) was amplified from Cerulean77 (a gift from Dave Piston; Addgene #15214) by PCR and the product cut with KpnI ...
-
bioRxiv - Cancer Biology 2023Quote: ... pH2B-GFP78 (a gift from Geoff Wahl; Addgene #11680) was cut with NotI ...