Labshake search

7951 - 8000 of 10000+ citations since 2019

• MEK1/2-Targeting PROTACs Promote the Collateral Degradation of CRAF in KRAS Mutant Cells

  Carlos Herrera-Montávez, et al., bioRxiv - Cancer Biology 2023

  Quote: pLKO-Tet-puro-hRAF1-shRNA-1 was a gift from Ayaz Najafov (Addgene plasmid # 185371 ...
• Immortalization and transformation of primary cells mediated by engineered ecDNAs

  Davide Pradella, et al., bioRxiv - Cancer Biology 2023

  Quote: ... pBABE-Puro and pBABE-Puro-HRASG12V plasmid were obtained from Addgene. For retrovirus production ...
• ASCL1-ERK1/2 Axis: ASCL1 restrains ERK1/2 via the dual specificity phosphatase DUSP6 to promote survival of a subset of neuroendocrine lung cancers

  Ana Martin-Vega, et al., bioRxiv - Cancer Biology 2023

  Quote: The short guide sequences (gDusp6-3C-Forward: caccGACGACTCGTATAGCTCCTG; gDusp6-3C-Reverse: aaacCAGGAGCTATACGAGTCGTC) were cloned into pSpCas9(BB)-2A-GFP (PX458) (Addgene) following the Sequence Cloning Protocol from Zhang Lab (https://www.addgene.org/crispr/zhang/) ...
• Musashi-2 (MSI2) regulation of DNA damage response in lung cancer

  Igor Bychkov, et al., bioRxiv - Cancer Biology 2023

  Quote: ... self-complementary single-stranded DNA oligos (Supp Table S2) were annealed and cloned into AgeI/EcoR1 sites of Tet-pLKO-puro vector (Addgene plasmid # 21915). All constructs were validated by direct sequencing ...
• Nuclear lamin A/C phosphorylation by loss of Androgen Receptor is a global determinant of cancer-associated fibroblast activation

  Soumitra Ghosh, et al., bioRxiv - Cancer Biology 2023

  Quote: ... was used to generate a Ser301 to Asp (S301D) mutant of lamin A/C from the wildtype lentiviral vector pCDH_blast_MCS_Nard_GFP_LAMIN (Addgene #167340) 64 ...
• Unique vulnerability of RAC1-mutant melanoma to combined inhibition of CDK9 and immune checkpoints

  Alexa C. Cannon, et al., bioRxiv - Cancer Biology 2023

  Quote: Cells were transduced with an H2B-GFP plasmid (Addgene 11680) and were seeded 0.25 × 105 cells onto 6 well plates and treated with +/-SHLD 1 ligand ...
• Glutamine antagonist DRP-104 suppresses tumor growth and enhances response to checkpoint blockade in KEAP1 mutant lung cancer

  Ray Pillai, et al., bioRxiv - Cancer Biology 2023

  Quote: ... Stk11 knockout tumors were generated by transient transfection of PX458 (Addgene 48138) expressing a guide targeting Lkb1 ...
• Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells

  Lisa Brunet, et al., bioRxiv - Cancer Biology 2023

  Quote: ... or standard cloning in the pTRIPZ plasmid from pTK-Slug (a gift from Robert Weinberg, Addgene plasmid # 36986) (Guo et al. ...
• Lineage-specific intolerance to oncogenic drivers restricts histological transformation

  Eric E. Gardner, et al., bioRxiv - Cancer Biology 2023

  Quote: ... packaging with psPAX2 (gift of D. Trono; Addgene plasmid #12260) and pseudo typed with pMD2.G (gift of D ...
• Lineage-specific intolerance to oncogenic drivers restricts histological transformation

  Eric E. Gardner, et al., bioRxiv - Cancer Biology 2023

  Quote: Inducible Myc constructs were created from synthetic fragments (Twist Biosciences) sub-cloned into a general backbone derived from LT3GEPIR (gift from J. Zuber; Addgene plasmid #111177) using Gibson Assembly reagents (NEB) ...
• A survey of CIN measures across mechanistic models

  Andrew R. Lynch, et al., bioRxiv - Cancer Biology 2023

  Quote: ... CAL51 cells were obtained from DSMZ-German Collection of Microorganisms and Cell Cultures and CAL51-TERF2-DN-tetOn was generated using retroviral transduction of pCMV Retro TetO into which we cloned the TERF2-DN mutant sequence (Addgene, 16069) and an mScarlet reporter ...
• Modeling wild type and mutant p53 in telomerase-immortalized human cells

  Jessica J. Miciak, Fred Bunz, bioRxiv - Cancer Biology 2023

  Quote: Cells were transfected with the plasmid pcDNA3_erGAP2 (a gift from Teresa Alonso and Javier García-Sancho, Addgene #78120), which encodes a low affinity fluorescent calcium biosensor ...
• Soluble CTLA-4 raises the threshold for T-cell activation and modulates anti-tumour immunity

  Paul T. Kennedy, et al., bioRxiv - Cancer Biology 2023

  Quote: ... US (Addgene plasmid #64874).
• ENPP1 is an innate immune checkpoint of the anticancer cGAMP-STING pathway

  Songnan Wang, et al., bioRxiv - Cancer Biology 2023

  Quote: ... Enpp1 guide sequences listed in Table S1 were cloned into the BbsI site of PX458-GFP or P458-mCherry backbones (synthesized by Addgene) following the protocol from Ryuji Morizane Lab at Harvard in order ...
• ENPP1 is an innate immune checkpoint of the anticancer cGAMP-STING pathway

  Songnan Wang, et al., bioRxiv - Cancer Biology 2023

  Quote: ... pLenti-TetONE-FLAG-Puro were synthesized by Addgene and used to generate E0771.lmb.PuroR cell line ...
• Inhibition of BCR::ABL1 tyrosine kinase activity Aids in the Generation of Stable Chronic Myeloid Leukemia Induced Pluripotent Stem Cells

  Esther Sathya Bama Benjamin, et al., bioRxiv - Cancer Biology 2023

  Quote: ... and pCXLE-hUL (Addgene: 27080) (kind gift from Shinya Yamanaka) ...
• Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells

  Lisa Brunet, et al., bioRxiv - Cancer Biology 2023

  Quote: ... by cloning annealed oligonucleotides containing the targeting sequence (Table S4) into the pSpCas9(BB)-2A-Puro vector (a gift from Feng Zhang, Addgene plasmid # 48139) (Ran et al. ...
• Prolonging lung cancer response to EGFR inhibition by targeting the selective advantage of resistant cells

  Lisa Brunet, et al., bioRxiv - Cancer Biology 2023

  Quote: ... mCherry-VIRHD and pLenti-puro-LacZ (a gift from Ie Ming Shih, Addgene plasmid # 39477) (Guan et al. ...
• Targeting Ovarian Cancer Stem Cells by Dual Inhibition of the Long Noncoding RNA HOTAIR and Lysine Methyltransferase EZH2

  Weini Wang, et al., bioRxiv - Cancer Biology 2023

  Quote: ... The sgRNA oligos targeting the different genomic regions of HOTAIR gene were synthesized and cloned into the BbsI site of PX548 (Addgene, Cat. No: 48138) construct following manufacturer’s instructions ...
• Structural dynamics at cytosolic inter-protomer interfaces control gating of a mammalian TRPM5 channel

  Sebastian Karuppan, et al., bioRxiv - Biophysics 2023

  Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
• Conserved allomorphs of MR1 drive specificity of MR1-restricted TCRs

  Terri V Cornforth, et al., bioRxiv - Cancer Biology 2023

  Quote: ... Lentiviral particles were packaged in HEK293T cells (ATCC: CRL-3216™) by co-transfection of pLentiCRISPR v2-β2m-gRNA with pRSV-rev (Addgene Plasmid #12253), pMDLg/pRRE (Addgene Plasmid #12251 ...
• Syntaxin clusters and cholesterol affect the mobility of Syntaxin1a

  Alan W. Weisgerber, et al., bioRxiv - Biophysics 2023

  Quote: ... peGFP(N1)-deltaCMV-rSyntaxin1a-meGFP (Addgene plasmid # 34631), and the SyxΔNT plasmid were gifts from Wolfhard Almers5 ...
• NSD2 maintains lineage plasticity and castration-resistance in neuroendocrine prostate cancer

  Jia J. Li, et al., bioRxiv - Cancer Biology 2023

  Quote: ... we used the lentiCas9-blast plasmid (Addgene 52962) and a custom vector for sgRNA (U6-sgRNA-EFS-Puro-P2A-TurboRFP in a pLL3-based lentiviral backbone ...
• NSD2 maintains lineage plasticity and castration-resistance in neuroendocrine prostate cancer

  Jia J. Li, et al., bioRxiv - Cancer Biology 2023

  Quote: Lentiviruses were generated by transfection of 293T cells with the indicated expression plasmid and the psPAX2 (Addgene 12260) and pVSVG (Addgene 14888 ...
• NSD2 maintains lineage plasticity and castration-resistance in neuroendocrine prostate cancer

  Jia J. Li, et al., bioRxiv - Cancer Biology 2023

  Quote: ... The other non-NE cells were transfected with H2B-RFP (Addgene 26001) lentivirus ...
• Histone H1.2 Dependent Translocation of Poly (ADP-ribose) Initiates Parthanatos

  Jing Fan, et al., bioRxiv - Cell Biology 2023

  Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
• Ninein domains required for its localization, association with partners dynein and ensconsin, and microtubule organization

  Marisa M. L. Tillery, et al., bioRxiv - Cell Biology 2023

  Quote: ... the coding sequence was inserted into pBID-UASC-GRM (RRID:Addgene_35203, (Wang et al., 2012)) ...
• Myosin 10 uses its MyTH4 and FERM domains differentially to support two aspects of spindle pole biology required for mitotic spindle bipolarity

  Yang-In Yim, et al., bioRxiv - Cell Biology 2023

  Quote: ... and pLenti-EGFP-Cre (Addgene, 86805). These plasmids were co-transfected with psPAX2 and pMD2.G (Addgene ...
• CRISPR/Cas9-mediated Generation of COL7A1-deficient Keratinocyte Model of Recessive Dystrophic Epidermolysis Bullosa

  Farzad Alipour, et al., bioRxiv - Cell Biology 2023

  Quote: ... The hybridized double-stranded (ghCOL7A1-S + ghCOL7A1-A) DNA fragment cloned into the Esp3I (BsmBI) restriction sites of the LentiCRISPRv2GFP (Addgene plasmid # 82416) using a simultaneous digestion-ligation reaction as described previously (16) ...
• Serine ubiquitination of p62 regulates Nrf2 dependent redox homeostasis

  Rukmini Mukherjee, et al., bioRxiv - Cell Biology 2023

  Quote: ... was cloned with a N terminal Myc tag in pCMV3 vector from SinoBiological (Catalog no: Cat: CV011) and in pcDNA3-HA2-Keap1 and pCDNA3-Myc3-Nrf2 are gifts from Yue Xiong (Addgene plasmid # 21556 ...
• Serine ubiquitination of p62 regulates Nrf2 dependent redox homeostasis

  Rukmini Mukherjee, et al., bioRxiv - Cell Biology 2023

  Quote: ... Matrix-roGFP and cyto-roGFP was a gift from Paul Schumacker (Addgene plasmid # 49437 and Addgene plasmid # 49435 ...
• Serine ubiquitination of p62 regulates Nrf2 dependent redox homeostasis

  Rukmini Mukherjee, et al., bioRxiv - Cell Biology 2023

  Quote: ... Matrix-roGFP and cyto-roGFP was a gift from Paul Schumacker (Addgene plasmid # 49437 and Addgene plasmid # 49435) (Waypa et al. ...
• Serine ubiquitination of p62 regulates Nrf2 dependent redox homeostasis

  Rukmini Mukherjee, et al., bioRxiv - Cell Biology 2023

  Quote: ... pLminP_Luc2P_RE4 was a gift from Ramnik Xavier (Addgene plasmid # 90338), (O’Connell et al. ...
• Actin Y53 Phosphorylation Regulates Somatic F-actin Radial Translocation to Promote Neuronal Polarization

  Shuai Hong, et al., bioRxiv - Cell Biology 2023

  Quote: ... pBa-KIF5C 559-tdTomato-FKBP was a gift from Gary Banker (Addgene plasmid # 64211; http://n2t.net/addgene:64211; RRID: Addgene_64211). mCherry-β-actin ...
• Actin Y53 Phosphorylation Regulates Somatic F-actin Radial Translocation to Promote Neuronal Polarization

  Shuai Hong, et al., bioRxiv - Cell Biology 2023

  Quote: ... PaGFP-UtrCH was a gift from William Bement (Addgene plasmid # 26738; http://n2t.net/addgene:26738; RRID: Addgene_26738; 24). mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149 ...
• Actin Y53 Phosphorylation Regulates Somatic F-actin Radial Translocation to Promote Neuronal Polarization

  Shuai Hong, et al., bioRxiv - Cell Biology 2023

  Quote: ... mRuby2-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 55889; http://n2t.net/addgene:55889; RRID: Addgene_55889). PaGFP-UtrCH was a gift from William Bement (Addgene plasmid # 26738 ...
• Actin Y53 Phosphorylation Regulates Somatic F-actin Radial Translocation to Promote Neuronal Polarization

  Shuai Hong, et al., bioRxiv - Cell Biology 2023

  Quote: ... mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149 ...
• Actin Y53 Phosphorylation Regulates Somatic F-actin Radial Translocation to Promote Neuronal Polarization

  Shuai Hong, et al., bioRxiv - Cell Biology 2023

  Quote: ... mMaroon1 (pcDNA3.1-mMaroon1) plasmid was provided by Michael Lin (Addgene plasmid # 83840; http://n2t.net/addgene: 83840; RRID: Addgene_83840; 30). mRuby2-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 55889 ...
• Actin Y53 Phosphorylation Regulates Somatic F-actin Radial Translocation to Promote Neuronal Polarization

  Shuai Hong, et al., bioRxiv - Cell Biology 2023

  Quote: ... mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149; http://n2t.net/addgene:57149; RRID: Addgene_57149). pBa-KIF5C 559-tdTomato-FKBP was a gift from Gary Banker (Addgene plasmid # 64211 ...
• Actin Y53 Phosphorylation Regulates Somatic F-actin Radial Translocation to Promote Neuronal Polarization

  Shuai Hong, et al., bioRxiv - Cell Biology 2023

  Quote: ... PaGFP-UtrCH was a gift from William Bement (Addgene plasmid # 26738 ...
• Proteomics reveals how the tardigrade damage suppressor protein teaches transfected human cells to survive UV-C stress

  Enxhi Shaba, et al., bioRxiv - Cell Biology 2023

  Quote: ... Kunieda Takekazu (Addgene plasmid #90019 ...
• Polycomb sustains promoters in a deep OFF-state by limiting PIC formation to counteract transcription

  Aleksander T. Szczurek, et al., bioRxiv - Cell Biology 2023

  Quote: ... guide sequences were designed using CRISPOR tool61 and cloned into pSptCas9(BB)-2A-Puro(PX459)-V2.0 guide expression plasmid (Addgene #62988). The complete list of guide sequences can be found in Supplementary Table 1 ...
• SARS-CoV-2 Envelope protein alters calcium signaling via SERCA interactions

  Blanka Berta, et al., bioRxiv - Cell Biology 2023

  Quote: ... For mCherry labelling we replaced eGFP to mCherry from pTK96_mCherry-MRLC2 (Addgene #46358) vector using AgeI and BsrGI sites ...
• SARS-CoV-2 Envelope protein alters calcium signaling via SERCA interactions

  Blanka Berta, et al., bioRxiv - Cell Biology 2023

  Quote: ... we amplified the SERCA2b cDNA from Addgene plasmid #75188 using SERCA specific forward 5’-GGGAGATCTATGGAGAACGCGCACACCAAGACGG-3’ and reverse 5’-GGGGTCGACTCAAGACCAGAACATATCGCTAAAGTTAG-3’ primers with overhanging BglII and SalI sites for pEGFP-C1 vector insertion ...
• Polycomb sustains promoters in a deep OFF-state by limiting PIC formation to counteract transcription

  Aleksander T. Szczurek, et al., bioRxiv - Cell Biology 2023

  Quote: ... FKBP12F36V (dTAG, Addgene #62988), MS2×128 array24 ...
• Angpt1 binding to Tie1 regulates the signaling required for lymphatic vessel development in zebrafish

  Nanami Morooka, et al., bioRxiv - Developmental Biology 2023

  Quote: ... The TALENs were cloned into an RCIscript-GoldyTALEN vector (Addgene). TALEN mRNAs were in vitro transcribed from SacI-linearized expression plasmids with T3 RNA polymerase using a mMessage mMachine mRNA kit (Thermo Fisher) ...
• Pooled endogenous protein tagging and recruitment for scalable discovery of effectors for induced proximity therapeutics

  Yevgeniy V. Serebrenik, et al., bioRxiv - Cell Biology 2023

  Quote: ... and sgRNAs and Cas9 were expressed from lentiCRISPR v2 (Addgene 52961). Virus was generated in HEK293T cells by transfection with the aforementioned transfer vectors and pMDLg (Addgene 12251) ...
• Nuclear envelope assembly relies on CHMP-7 in the absence of BAF-LEM-mediated hole closure

  Sarah R. Barger, et al., bioRxiv - Cell Biology 2023

  Quote: ... Unique sgRNAs were cloned into the Cas9 guide plasmid pDD122 (Addgene, #47550). Following sequencing ...
• Novel phosphatidylinositol flippases contribute to phosphoinositide homeostasis in the plasma membrane

  Yumeka Muranaka, et al., bioRxiv - Cell Biology 2023

  Quote: ... The cDNAs of P4M (plasmid #51472) (Hammond et al., 2014) and PLCδ-PH domain (plasmid #21179) (Stauffer et al., 1998) were obtained from Addgene. The tRFP cDNA was a gift from Hideki Shibata (Nagoya University ...
• Novel phosphatidylinositol flippases contribute to phosphoinositide homeostasis in the plasma membrane

  Yumeka Muranaka, et al., bioRxiv - Cell Biology 2023

  Quote: ... target sequences are underlined) were synthesized and introduced into the BbsI-digested vector PX459 (Addgene plasmid #48139). To edit the CDC50A gene ...