-
No products found
because this supplier's products are not listed.
Eric J. Montemayor, et al.,
bioRxiv - Biochemistry 2020
Quote:
Codon optimized open reading frames (Genscript) for S ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... The hACE2 open reading frame (Addgene# 1786) was cloned into a 3rd generation lentiviral expression vector pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene# 122053) ...
-
No products found
because this supplier's products are not listed.
Bojan F. Hörnich, et al.,
bioRxiv - Microbiology 2021
Quote:
... by amplifying the TurboGFP open reading frame from the vector pGIPZ (Thermo Scientific Open Biosystems) using the primers TurboGFP for Gal4Luc before ATG ov (GGTACTGTTGGTAAAATGGAGAGCGACGAGAGC ...
-
No products found
because this supplier's products are not listed.
Lucie Zilova, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Adjustment of open reading frame following the splice acceptor was accomplished via Q5 (NEB) mutagenesis by inserting a single or two nucleotides (+1 or +2 ...
-
No products found
because this supplier's products are not listed.
Auke B.C. Otten, et al.,
bioRxiv - Cell Biology 2021
Quote:
... open reading frames were PCR-amplified using CloneAmp HiFi PCR Premix (Clontech), gel-purified using the Nucleospin® Gel and PCR Clean-Up kit (Macherey-Nagel) ...
-
No products found
because this supplier's products are not listed.
Kentaro Ikegami, et al.,
bioRxiv - Cell Biology 2019
Quote:
Open reading frames of OR genes were subcloned into pCI (Promega) with a Rho tag at the N terminal ...
-
No products found
because this supplier's products are not listed.
Raphaël Pantier, et al.,
bioRxiv - Biochemistry 2020
Quote:
... TET1 open reading frame was subcloned into pRSFDuet plasmids (Novagen) for exogenous expression of MBP-tagged proteins in E ...
-
No products found
because this supplier's products are not listed.
Atossa C. Ghorashi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... to amplify the open reading frame (ORF) of each gene (Origene, catalog no ...
-
No products found
because this supplier's products are not listed.
Marshall Lukacs, et al.,
bioRxiv - Genetics 2019
Quote:
... into the complete open reading frame of the canonical 307 amino acid human NMNAT2 isoform cloned into expression vector pCMV-Tag2 (Stratagene). The expressed NMNAT2 proteins have a Flag tag and short linker sequence (17 amino acids ...
-
No products found
because this supplier's products are not listed.
Houqing Yu, Roarke A. Kamber, Vladimir Denic,
bioRxiv - Molecular Biology 2021
Quote:
... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
No products found
because this supplier's products are not listed.
Luciana Lazar-Stefanita, et al.,
bioRxiv - Genetics 2023
Quote:
... pombe chromosomes (BioRad, 170-3633) to maximize size resolution of the largest chromosomes ...
-
No products found
because this supplier's products are not listed.
Julia L. de Amorim, et al.,
bioRxiv - Biochemistry 2023
Quote:
The Exosc3 open reading frame encoding the mouse EXOSC3 protein was cloned into pGEX-6P-2 plasmid (GE Healthcare Life Sciences (now Cytiva)) to create an N-terminally glutathione-S-transferase (GST ...
-
No products found
because this supplier's products are not listed.
Yukun He, et al.,
bioRxiv - Genetics 2023
Quote:
... and images of chromosome spread were captured using an automated cytogenetic imaging system (Leica, GSL-10).
-
No products found
because this supplier's products are not listed.
Gianni Carraro, et al.,
bioRxiv - Cell Biology 2020
Quote:
... FOXJ1 (14-9965-82, Biolegend), KRT5 (905904 ...
-
No products found
because this supplier's products are not listed.
Darko Bosnakovski, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A codon optimized version of the ENSOANG00000047618 open reading frame was synthesized by Biomatik. cDNAs for DUXA and DUXB were synthesized by Integrated DNA Technologies ...
-
No products found
because this supplier's products are not listed.
Xiaoxiao Zhang, et al.,
bioRxiv - Biochemistry 2024
Quote:
Complete open reading frame of murine pro-CtsK (GE Dharmacon) were cloned into pUNO1 (Invivogen) expression vector using AgeI and NheI restriction sites ...
-
No products found
because this supplier's products are not listed.
Anatolie Marta, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
Mitotic chromosomes were examined by Olympus BX53 epifluorescence microscope and Axio Imager Z2 microscope equipped with CCD camera (DP30W Olympus ...
-
No products found
because this supplier's products are not listed.
Anatolie Marta, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
During immunofluorescent staining we visualized synaptonemal complexes (SC) of pachytene chromosomes using rabbit polyclonal antibodies (ab14206, Abcam) against SYCP3 protein (the lateral component of SC ...
-
No products found
because this supplier's products are not listed.
Fernando Y. Maeda, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Images were acquired at 1 frame/6-10 s and analyzed using Volocity (PerkinElmer) and NIH ImageJ ...
-
No products found
because this supplier's products are not listed.
Charlotte Rimbault, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Images were acquired by image streaming for up to 4000 frames (sptPALM) or up to 20000 frames (PALM) at frame rate of 50 Hz using Metamorph software (Molecular Devices, USA), and analysis were performed with a homemade software developed under MetaMorph and kindly provided by J.B ...
-
No products found
because this supplier's products are not listed.
Jennifer Blaze, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and a stereotactic frame (Stoelting). Stereotactic coordinates for mPFC injection were as follows ...
-
No products found
because this supplier's products are not listed.
Pavla Navrátilová, et al.,
bioRxiv - Genomics 2021
Quote:
... Chromosomes were counterstained by 10 μg/ml 4Ͱ,6-diamidino-2-phenylindole (DAPI) in Vectashield antifade mounting medium (Vector Laboratories). Images were captured using an epifluorescence microscope BX61 (Olympus ...
-
No products found
because this supplier's products are not listed.
Leah S. VandenBosch, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Mice having EGFP knocked-into the Sox2 open reading frame were obtained from Jackson Laboratories (Stock: 017592) and bred to generate P2 litters(Arnold et al ...
-
No products found
because this supplier's products are not listed.
David Baidoe-Ansah, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 2017) (Suppl. Table 1) targeting the open reading frame into AAV U6 GFP (Cell Biolabs Inc., San Diego, CA, USA) using BamH1 (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Srijan Jhingan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5’ and 3’ untranslated regions and open reading frames) for the paralogs were made using the CLC Main workbench 7 (QIAGEN® Aarhus A/S, Aarhus C, Denmark). Sequence alignments were generated for the genomic DNA ...
-
No products found
because this supplier's products are not listed.
Ivana Grbesa, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Luminescence readings (BioTek Synergy Neo microplate reader with Gen5 software ...
-
No products found
because this supplier's products are not listed.
Abhinay Ramaprasad, et al.,
bioRxiv - Genomics 2020
Quote:
... haematocrit readings (Beckman Coulter Counter) and body weight readings were taken daily for 20 days or until host mortality to monitor parasitaemia ...
-
No products found
because this supplier's products are not listed.
Benjamin L. Woods, et al.,
bioRxiv - Cell Biology 2021
Quote:
... microscope (Nikon Ti-82 stage) using a 100x Plan Apo 1.49 NA oil objective and a Prime 95B cMOS camera (Photometrics).
-
No products found
because this supplier's products are not listed.
Shalini Trivedi, Jitka Blazicková, Nicola Silva,
bioRxiv - Genetics 2022
Quote:
... 1µg of DNA was labeled with digoxigenin (for chromosome III) or biotin (for chromosome V) by nick-translation according to manufacturer instructions (Roche, 11745816910 and 11745824910).
-
No products found
because this supplier's products are not listed.
Yun Hwa Choi, et al.,
bioRxiv - Immunology 2023
Quote:
... and open-field (LE802S from Panlab Harvard Apparatus). Rotarod tests were conducted for 3 minutes on a rotating cylinder with constant speed at 8 rpm.
-
No products found
because this supplier's products are not listed.
Christopher M. Driskill, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Recording electrodes (WPI; 4–6 MΩ open tip resistance) were filled with an internal solution consisting of (in mM) ...
-
No products found
because this supplier's products are not listed.
Anke Hüls, et al.,
bioRxiv - Genetics 2019
Quote:
... 2) probes annotated to the X and Y chromosomes by Illumina, 3 ...
-
No products found
because this supplier's products are not listed.
Berta Canal, et al.,
bioRxiv - Biochemistry 2021
Quote:
... started reading fluorescence in all wells every 1 min for 10 min using a Spark Multimode microplate reader (Tecan) with the following settings ...
-
No products found
because this supplier's products are not listed.
Ik-Jung Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... The GFP-Flag was constructed by replacing the ORF8-Strep of ORF8-Strep with the GFP-Flag open reading frame sequence (Sino Biological). ORF8-Flag I9P was constructed by replacing ATT with CCT at I9 of ORF8-Flag ...
-
No products found
because this supplier's products are not listed.
Eishi Aizawa, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Chromosomes were stained with Giemsa solution (Merck), washed with Gurr’s buffer ...
-
No products found
because this supplier's products are not listed.
Emma V. Waters, et al.,
bioRxiv - Genomics 2022
Quote:
... Overnight cultures were used to inoculate 200 µL isosensitest broth to an OD600 of ∼0.1 before OD readings were taken every 10 min over 11 hrs with a Fluostar Optima Microplate Reader (BMG Labtech).
-
No products found
because this supplier's products are not listed.
Sachin G. Chavan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... open-mode gas exchange system (LI-6400XT, LI-COR, Lincoln, USA) during ascending and descending photoperiod in September 2019 and March 2020 ...
-
No products found
because this supplier's products are not listed.
Qingting Yu, et al.,
bioRxiv - Neuroscience 2023
Quote:
... PDGFRβ (AF1042, R&D Systems; 14-1402-82, ThermoFisher), MYH11 (ab224804 ...
-
No products found
because this supplier's products are not listed.
Seyed Soheil Saeedi Saravi, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 14-0311-82) was purchased from eBioscience; antibody against Histone H3ac (Pan-Acetyl) (1:500; sc-518011) was obtained from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Abhishek Anand, et al.,
bioRxiv - Microbiology 2023
Quote:
... similar readings were taken using 6-well plates (Corning, NY, USA) (Figure 3a) ...
-
No products found
because this supplier's products are not listed.
Tianyi Liu, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 10 mg of BRAF antibody (Cell Signaling Technology, 9433) or mouse IgG (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Jaime de Anda, et al.,
bioRxiv - Microbiology 2023
Quote:
... One minute fluorescence recordings were taken with 100 ms exposure for a 10fps recording (shutters were continuously open and without display feedback to maximize frame rate) with Lambda LS (Sutter Instrument) xenon arc lamp and a green fluorescent protein (GFP ...
-
No products found
because this supplier's products are not listed.
Marine Brunet, et al.,
bioRxiv - Cell Biology 2023
Quote:
Alms1a-Tomato was integrated in the 89E11 VK00027 landing site on the third chromosome and Alms1b-GFP on the 53B2 VK00018 landing site on the second chromosome by PhiC31 integrase (BestGene Inc.).
-
No products found
because this supplier's products are not listed.
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Deltarasin (CAS #1440898-82-7; Tocris Bio-Techne #5424 ...
-
No products found
because this supplier's products are not listed.
Cyntha M. van den Berg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Movies consisting of 8-10 frames were recorded using a K2 Summit direct electron detector (Gatan), with a target total electron dose of 80 e−/Å2 ...
-
No products found
because this supplier's products are not listed.
Yan Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... was typically acquired at eight to ten frames using a 10× C Epiplan-Apochromat objective (0.4-NA, 5.4-mm free working distance, Carl Zeiss) at typically 512×512 pixel resolution with lasers tuned at 488 nm and at 561 nm and emission at 500–550 nm for green and 620–700 nm for red fluorescence ...
-
No products found
because this supplier's products are not listed.
Emily Neil, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the slides were mounted into MACSwell Imaging Frames (Miltenyi Biotec).
-
No products found
because this supplier's products are not listed.
Minjie Tan, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 10 µg TDRKH antibody (13528-1-AP, Proteintech) or rabbit Immunoglobulin (X0903 ...
-
No products found
because this supplier's products are not listed.
Mengdi Guo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 250µg antibodies (Clone 10 F.9G2, BioXcell Cat#BE0101) or isotype control (rat IgG2b Clone LTF-2 ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Secondary antibody (Jackson Immunoresearch Anti-Rabbit, 111-035-144; 1:10 000), was applied at room temperature for one hour ...