Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Chromosome 10 Open Reading Frame 82 C10ORF82 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... by amplifying the TurboGFP open reading frame from the vector pGIPZ (Thermo Scientific Open Biosystems) using the primers TurboGFP for Gal4Luc before ATG ov (GGTACTGTTGGTAAAATGGAGAGCGACGAGAGC ...
-
bioRxiv - Plant Biology 2021Quote: ... Open reading frames were PCR amplified (Phusion Hotstart II polymerase, ThermoFisher Scientific or KOD DNA polymerase ...
-
bioRxiv - Plant Biology 2020Quote: ... All open reading frames were cloned into pENTR/D-TOPO (Thermo-Fisher Scientific). The resulting entry vectors were recombined into destination vectors using the LR reaction mix II (Thermo-Fisher Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... the open reading frame of PHT1;1 was cloned into pCR8/GW/TOPO (Invitrogen) and then recombined into the Gateway destination vector pMDC32 ...
-
bioRxiv - Microbiology 2021Quote: Codon optimised open reading frames encoding spike proteins were synthesised (GeneArt, Thermo Fisher) and cloned into pCDNA3.1 and/or pD603 (ATUM ...
-
bioRxiv - Physiology 2023Quote: ... cloning of the open reading frame into a pENTR/D-TOPO vector (Invitrogen) was carried out using first strand complementary DNA (cDNA ...
-
bioRxiv - Plant Biology 2024Quote: ... the corresponding AtPIN5 open reading frame was cloned with the Gateway system (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: The MmFLVCR2 full-length open-reading frame was cloned into pBacMam (Thermo Fisher Scientific) using ligation-independent cloning39 ...
-
Synthetase and Hydrolase Specificity Collectively Excludes 2’-Deoxyguanosine from Bacterial AlarmonebioRxiv - Microbiology 2024Quote: ... baumannii SpoT open reading frame (ORF) was sub-cloned into pET SUMO vector (Invitrogen) immediately downstream of the His6-SUMO ORF ...
-
bioRxiv - Plant Biology 2020Quote: ... The resulting open reading frame was cloned into pENTR/D-TOPO (Life Technologies, Darmstadt, Germany), sequenced and recombined into the Gateway-compatible destination vector pK7FWG,0 (Karimi et al. ...
-
bioRxiv - Developmental Biology 2021Quote: Codon optimized open reading frames for constructs (synthesized by GeneArt®, Life Technologies Ltd., Paisley,UK), with recommended BiP signal peptide (for secretion) ...
-
bioRxiv - Microbiology 2020Quote: ... anthracis open reading frames was acquired from BEI Resources and used for Gateway cloning (Invitrogen protocol) into overexpression vectors pVL791 (10xHis tag ...
-
bioRxiv - Microbiology 2020Quote: ... anthracis open reading frames was acquired from BEI Resources and used for Gateway cloning (Invitrogen protocol) into overexpression vectors pVL791 (10xHis tag ampicillin-resistant ...
-
bioRxiv - Molecular Biology 2020Quote: ... Rec102 and Rec104 were generated by cloning the corresponding open reading frame from SK1 in pFastBac1 (Invitrogen).
-
bioRxiv - Cell Biology 2020Quote: ... NM2C open reading frame PCR product was TOPO cloned into the pCR8/GW/TOPO vector (K250020; Invitrogen) and then shuttled into the pHalo-C1 backbone ...
-
bioRxiv - Microbiology 2020Quote: ... The sequence-verified open reading frames were subcloned into a pYES-DEST52 yeast expression vector (ThermoFisher Scientific) by the LR reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... we generated an open reading frame (ORF) for CDA by PCR that was subcloned in pDonor221 (Invitrogen). CDA E67Q catalytically inactive mutant42 was generated by site directed mutagenesis according to the manufacturer instructions (New England Biolabs) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we amplified the full-length open reading frame using the high-fidelity Phusion DNA Polymerase (Thermo Fisher Scientific) and the primer combination TPS38f and TPS38r (Table S1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... thus leading to a fusion of the emdyp open reading frame with the anti-V5 epitope tag (Invitrogen) and a hexahistidine tag ...
-
bioRxiv - Neuroscience 2023Quote: ... miRmDia1 (start position 4892, targeting sequence matches open-reading frame) was designed with BLOCK-iTTM (Thermo Fisher Scientific) and subcloned into shCTRmiR to yield shmDia1miR following protocol in (Ritter et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... mVenus was cloned solely or with an open reading frame of SUF4 isoform 1 (NP_564369.1; 367 amino acid) in the modified pFastBac vector (ThermoFisher). Site-directed mutagenesis was carried out to create the 5S and 12S mutants using PrimeSTAR Max DNA polymerase (Takara-bio) ...
-
bioRxiv - Biochemistry 2021Quote: The F56E mutation was introduced into the Drl coding region in the pENTR vector using oligonucleotide-mediated mutagenesis, and the open reading frame was subsequently transferred into pTWM-attB (L.G.F., unpublished) using LR Clonase (ThermoFisher Scientific) to generate Drl-F56E-(6x)-Myc ...
-
bioRxiv - Systems Biology 2022Quote: ... the open reading frames without stop codon were PCR -amplified by Phusion™ High-Fidelity DNA Polymerase (Thermo Fisher) using the forward and reverse primer pairs ...
-
bioRxiv - Plant Biology 2024Quote: Open reading frames of selected candidate genes were amplified from cDNA prepared with Maxima Reverse Transcriptase (Thermo Fisher Scientific) according to manufactureres instruction using leaf RNA that had been extracted using the Spectrum Plant Total RNA Kit (Merck KGaA ...
-
bioRxiv - Plant Biology 2024Quote: ... the corresponding AtPIN5 open reading frame was cloned with the Gateway system (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) into the pMDC7 vector (Curtis & Grossniklaus ...
-
bioRxiv - Neuroscience 2020Quote: Drosophila CREG cDNA was obtained by amplifying the single open reading frame from genomic DNA by PCR and cloning directly in to the pENTR vector (Gateway Technology; Invitrogen). We engineered a CACC site in the forward primer for the subsequent Gateway reaction ...
-
bioRxiv - Microbiology 2020Quote: The sequence containing the first 186 amino acids of LacZ (LacZ186) and the super-folder GFP (sfGFP) open reading frame (78) expressed by J23119 constitutive promoter was obtained from ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Open reading frames (ORFs) of PjIPT1a and PjIPT1b were first cloned into pENTR/D-TOPO entry vector (Thermo Fisher Scientific) to generate GFP fusion constructs using the pGWB5 binary vector (Nakagawa et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmids were linearized following the open reading frame and used as a template for mRNA synthesis using the mMessage Machine SP6 kit (Ambion), mRNAs were polyadenylated using a Poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... Virus stocks were confirmed by sequencing (ACGT Inc.) the PB2 and PB1 open reading frames (ORFs) using purified total RNA (Trizol reagent, Invitrogen) from infected MDCK cells (106 cells/well ...
-
bioRxiv - Biochemistry 2022Quote: ... sty15CS+ and sty1T97A genes including 1.5kb of the sty1 promoter up stream of the open reading frames were amplified by Phusion (Thermo Scientific) PCR from NT5 ...
-
bioRxiv - Developmental Biology 2020Quote: A kctd15a pCS2 construct was designed with Not1 and XhoI flanking the open reading frame allowing for in vitro synthesis of full-length sense cRNA using an SP6 mMessage Machine kit (Ambion). 60 pg of kctd15a cRNA was injected into one-cell stage embryos for overexpression ...
-
bioRxiv - Microbiology 2021Quote: ... the GFP open reading frame of BAC16 was replaced with a Zeocin resistance gene by amplifying the resistance gene from pcDNA6 (Invitrogen) using Phusion PCR (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... the coding sequences of all open reading frames of TBEV Hypr were cloned and recombined into the pPC97 plasmid (Invitrogen) downstream of the DNA-binding domain of the Gal4 transcription factor (Gal4-DB ...
-
bioRxiv - Cell Biology 2020Quote: ... Identified and characterized plasmids containing the ACE2 isoform open reading frames were transfected into the HEK-293 cells using TurboFect reagent (ThermoFisher Corp.). 24 hours post-transfection the cells were harvested and processed for analysis by western blot according to established procedures [21] ...
-
bioRxiv - Genetics 2020Quote: We PCR amplified and cloned the IL7 wildtype (rs201412253-Val18) and mutant (rs201412253-18Ile) open reading frame (ORF) in the pcDNA5/FRT vector (ThermoFisher Scientific) using HindIII and BamHI restriction sites (see Supplementary Table 22 for ORF and primer sequences) ...
-
bioRxiv - Cell Biology 2021Quote: A pENTR-D clone of the full-length Pex14 open reading frame (Baron et al., 2016) was transferred to pDEST-17 (Thermo Fisher) using LR ClonaseII (Thermo Fisher 11791-020) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Missense mutation was introduced into the open reading frame using the QuikChange Site Directed mutagenesis kit (c.440G>A) (Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The specific miRNA-based shRNA against the mouse open reading frame (ORF) for MSK1 were generated using the BLOCK-iT™ RNAi Designer software (Invitrogen) and cloned into the pcDNA6.2-GW/miR vector according to instructions provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... The open reading frames of Irk1WT-RR and Irk1V306A-RR were then recombined into pUASg.attB using LR Clonase II (Thermo Fisher Cat #11791020) to generate pUASg.attB-Irk1WT-RR and pUASg.attB-Irk1V306A-RR (Supplemental Table 8) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products derived from WT NTUH-K2044 containing the terC or terZABCDEF open reading frames were inserted into pCR 2.1 using TOPO TA cloning (Life Technologies, Carlsbad, CA) and subsequently ligated into pACYC184 following digestion with Xbal and HindIII ...
-
bioRxiv - Genetics 2022Quote: ... The LR Gateway reaction was used to recombine the wild-type or mutant AARS1 open reading frame from pDONR221 into pDEST40 (Thermo Fisher Scientific) or pTM3xFLAG (gift from Moran Laboratory ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA was obtained by RT-PCR using specific primers for amplifying the open reading frame (ORF) of VP7 or NSP4 and cloned into pcDNA3 (Life Technologies, USA) as KpnI-EcoRI fragments ...
-
bioRxiv - Molecular Biology 2022Quote: ... and YrbA open reading frames (ORFs) were generated by polymerase chain reaction (PCR) and AccuPrime Taq DNA Polymerase (Thermo Fisher Scientific, USA). The sequences of the primers used for PCR are shown in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: The open reading frame of both the CaMATE1 and CabHLH was cloned in the gateway vector pENTER-D-Topo (Invitrogen, Waltham, MA) with primers MATE1pE_F ...
-
bioRxiv - Plant Biology 2021Quote: ... The PKN1OE construct was created by cloning the PKN1 open reading frame (ORF) including stop codon from Col-0 into pDONR221 (Invitrogen, creating pDONR221-PKN1) via a BP reaction and subsequently recombining it via an LR reaction behind the strong Cauliflower Mosaic Virus (CaMV ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs encoding for CpxII or its mutant variants were sub-cloned into the first open reading frame (ORF) of a bicistronic Semliki Forest vector (pSFV1, Invitrogen, San Diego, CA). Enhanced-GFP expression from the second ORF allowed for the identification of infected cells.
-
bioRxiv - Neuroscience 2021Quote: ... we amplified the open reading frames of the mammalian SLC5A genes from their respective cDNA plasmids which were obtained from Thermo Fisher (see Table 4). We generated UAS-based expression plasmids using pUAST-attB-rfa and inserted them into 51CRFP+ landing site.
-
bioRxiv - Developmental Biology 2021Quote: ... full-length open reading frame sequences coding for SlCRCa and SlCRCb proteins were cloned into the pENTR/D-TOPO vector (Invitrogen Life Technologies, San Diego, CA, USA) and recombined into the Gateway binary vector pGWB6 (Nakagawa et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... full-length open reading frame sequences coding for SlCRCa and SlCRCb proteins were cloned into the pENTR/D-TOPO vector (Invitrogen Life Technologies, San Diego, CA, USA) and recombined into the Gateway binary vector pGWB6 (Nakagawa et al. ...