Labshake search
Citations for BestGene :
1 - 30 of 30 citations for Chromosome 10 Open Reading Frame 82 C10ORF82 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Alms1a-Tomato was integrated in the 89E11 VK00027 landing site on the third chromosome and Alms1b-GFP on the 53B2 VK00018 landing site on the second chromosome by PhiC31 integrase (BestGene Inc.).
-
bioRxiv - Neuroscience 2021Quote: ... cDNA were subcloned into pUASTattB vector and injected in attP2 lines (on the III chromosome) and in attP40 lines (on the II chromosome) (BestGene Inc., CA, USA). rh1-Gal4 ...
-
bioRxiv - Developmental Biology 2019Quote: ... yw embryos for integration into the 2nd chromosome attp16 locus by BestGene Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting constructs were injected into a yv;;attP 3rd chromosome docking strain by BestGene Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... and it was utilized for attp154 landing site-specific integration on the 2nd chromosome (Bestgene).
-
bioRxiv - Developmental Biology 2022Quote: ... The plasmid was inserted into the attP40 site on chromosome II to generate transgenic flies (Bestgene).
-
The gut hormone Allatostatin C regulates food intake and metabolic homeostasis under nutrient stressbioRxiv - Physiology 2020Quote: ... and correct constructs were integrated into the fly genome at the attP2 (third chromosome) site by BestGene, Inc ...
-
bioRxiv - Genetics 2022Quote: ... Transgenes were sequence-verified and injected into VK33 on chromosome 3L and screened for positive transformants by BestGene. Recombinant flies were generated by crossing transgenic flies with flies containing Set820 and screening single F2 male progeny for the presence of both the appropriate transgene and Set820.
-
bioRxiv - Neuroscience 2019Quote: ... 2nd chromosome transgenic lines (attP16) were generated using ϕC31-mediated transgenesis 74 (BestGene Inc., Chino Hills, CA, USA).
-
bioRxiv - Cell Biology 2021Quote: ... 2017) and were injected in embryos for targeted insertion on the attP40 site located on second chromosome (BestGene Inc.).
-
bioRxiv - Neuroscience 2019Quote: ... Transgenic flies with site-specific insertions at VK0005 site on chromosome 3 were generated using standard microinjection (BestGene, Inc.).
-
bioRxiv - Cell Biology 2019Quote: ... UASp-CFP-Msps plasmid was injected into embryos for targeted insertion on chromosome 3 at ZH-96E by Bestgene, Inc.
-
bioRxiv - Neuroscience 2022Quote: ... The final CEPIA1er::hPDFGR-TM::P2A::TagRFP::hPDFGR-TM construct was transformed into chromosome III of w1118 by Bestgene, Inc (Chino Hills ...
-
bioRxiv - Genetics 2023Quote: ... These 3 constructs were recombined into the attP landing site on chromosome 3L in BDSC stock #8622 (y1 w67c23; P{y+t7.7=CaryP}attP2) by BestGene, Inc.
-
bioRxiv - Cell Biology 2020Quote: ... Transgenes were sequenced and then injected into embryos containing an attP8 site on the X chromosome (BDSC stock #32233, BestGene).
-
bioRxiv - Developmental Biology 2022Quote: The plasmids obtained were injected into flies (BDSC 9744) which contain an attP-9A insertion at 3R chromosome (89E11) by BestGene.
-
bioRxiv - Developmental Biology 2021Quote: ... constructs were integrated into the third chromosome using the ϕC31-based integration system55 at the VK33 site (65B2) by BestGene. NLS-mCherry-LEXY and NLS-EGFP-LEXY constructs were integrated into the second chromosome at the VK02 site (47C6) ...
-
bioRxiv - Physiology 2023Quote: ... and correctly assembled clones were midi-prepped using Qiagen kits and integrated into the genome at the attP2 third-chromosome site by BestGene, Inc (Chino Hills ...
-
bioRxiv - Genetics 2023Quote: ... This BAC was inserted into the attP landing site on chromosome 3R in BDSC stock #9744 (y1 w1118; PBac{y+-attP-9A}VK00027) by BestGene, Inc.
-
bioRxiv - Cell Biology 2023Quote: ... This plasmid was co-injected along with two gRNA-expressing plasmids (pU6-Bbs1-ChiRNA containing gRNA1: GATCCACTGGCTCTCGCTTA and gRNA2: GCATCAGGTTCACCTCAGAGG in embryos from the nos-Cas9 strain (2nd chromosome, BDSC78781) by Bestgene Inc ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryo injection to introduce the transgene into the 2nd-chromosome through P element-mediated transformation was carried out by BestGene Inc.
-
bioRxiv - Neuroscience 2024Quote: ... The synthesized constructs were injected into flies and targeted to attP1 or attP2 insertion sites on the second or third chromosomes respectively and the transgenic progeny were balanced either over CyO or TM6C (BestGene). Expression was verified by imaging of eYFP fluorescence with a Leica TCS SP8 STED confocal microscope ...
-
bioRxiv - Neuroscience 2024Quote: ... RRID: 8622) located at 68A4 on the 3rd chromosome were then produced using standard methods (BestGene, Inc., Chino Hills, CA). Subsequent lines were verified by genomic sequencing and a single line chosen for experiments.
-
bioRxiv - Neuroscience 2021Quote: ... Transgenic flies were generated via standard procedures and φc31-mediated transposition into the Drosophila genome at the VK00027 landing site located on chromosome 3 (BestGene Inc.). To select larvae of the correct genotype for immunhistochemistry and behavior assays ...
-
bioRxiv - Neuroscience 2019Quote: ... The pJFRC177-10X-UAS-FRT-stop-FRT-GtACR1 construct was injected into the attP2 insertion site on the third chromosome (BestGene Inc.), and the transgenic progeny were balanced.
-
bioRxiv - Developmental Biology 2023Quote: ... the pQUASamB-Lsp1α-HA and pQUASattB-Lsp2-HA constructs were introduced into the germ line by injections in the presence of the PhiC31 integrase and inserted in the attP40 docking site on the second chromosome (BestGene Inc.). Lsp1α-HA and Lsp2-HA sequences were synthesized by ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... The various transgenic reporters were integrated into the VK37 site on chromosome 2 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA). L3 brains from reporter fly lines were dissected ...
-
bioRxiv - Developmental Biology 2021Quote: ... These transgenes were integrated at ZH-86Fb site on chromosome 3 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA). Worniu-Gal4 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The various transgenic reporters were integrated into the VK31 site on chromosome 3 using φC31-mediated integration (Bischof and Basler, 2008) (BestGene, Chino Hills, CA).
-
bioRxiv - Developmental Biology 2022Quote: ... These transgenes were integrated at ZH-86Fb site on chromosome 3 using φC31-mediated integration (Bischof and Basler 2008) (BestGene, Chino Hills, CA). The Wor-Gal4 ...