-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Milad Radiom, et al.,
bioRxiv - Biophysics 2021
Quote:
... We adhered a dual adhesive Gene Frame (thickness 250 μm, Abgene, Advanced Biotech) to a cover slip ...
-
No products found
because this supplier's products are not listed.
Rachel A. Hoffman, David M. MacAlpine,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were doubled (based on OD600 readings) and then arrested for 2 hours using α-factor (Genway) at a final concentration of 50 ng/mL ...
-
No products found
because this supplier's products are not listed.
Eliana Nachman, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... 5 mM MgCl2) were formed in 12 ml open-top polyclear centrifuge tubes (Seton Scientific) on the Gradient Station ip (BioComp Instruments). Tau fibrils were incubated with the disaggregation machinery at 30 °C and after 0.5 h and 4 h aliquots were taken from the reaction mix and applied to the sucrose gradients ...
-
No products found
because this supplier's products are not listed.
Chandra S. Bathula, et al.,
bioRxiv - Biochemistry 2021
Quote:
... mice were maintained for 10 days on a fresh liquid diet (free access) containing 5% ethanol (vol/vol) (Lieber-DeCarli ‘82 Shake and Pour ethanol liquid diet; product number F1258SP; Bio-Serv) or pair-fed with a control isocaloric diet (Lieber-DeCarli ‘82 Shake and Pour control liquid diet ...
-
No products found
because this supplier's products are not listed.
Elisabeth Koert, Thomas Kuenzel,
bioRxiv - Neuroscience 2020
Quote:
... Washed (TRIS-buffered saline containing 0.3 % Triton X-100) slices were then mounted in Fluoprep medium (bioMerieux) surrounded by a spacer frame (240 µm adhesive tapes; Grace Bio-Labs) between two glass coverslips.
-
No products found
because this supplier's products are not listed.
Ping Lv, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The primary antibodies included TMOD4 antibody (CUSABIO, China, CSB-PA609953ESR2HU); HuR antibody (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Yejin Lee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 10 ng of PRKACA (SignalChem) was incubated with 5 µg of huntingtin in a buffer containing 50 mM Tris-HCl pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Heather L. Caslin, et al.,
bioRxiv - Immunology 2022
Quote:
... and 10% L929 conditioned media (or 10 ng/mL M-CSF; Shenandoah Biotech # 200-08) in T75 flasks.
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals) at a dilution of 100 folds ...
-
No products found
because this supplier's products are not listed.
Jing Zhao, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and GST antibody (Tiangen).
-
No products found
because this supplier's products are not listed.
Vanessa Simões, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 2-10 µM of ubiquitin (LifeSensors si201), 10 µg of isolated ribosomes ...
-
No products found
because this supplier's products are not listed.
Prachiti Moghe, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... containing 10% serum substitute supplement (Irvine Scientific). The COCs were stripped off cumulus cells with 0.5 mg/ml hyaluronidase (Sigma Chemical) ...
-
No products found
because this supplier's products are not listed.
Tom Alsaigh, et al.,
bioRxiv - Genomics 2020
Quote:
... 10% FBS+Complete EC media (Cell Applications, Inc) was immediately added to dissociated tissue to quench enzymatic activity ...
-
No products found
because this supplier's products are not listed.
Nguyen P.T. Huynh, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 10 mM β-glycerol phosphate (Chem-Impex International), 100 ng/mL rh-BMP2 (ThermoFisher) ...
-
No products found
because this supplier's products are not listed.
Zarina Brune, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... fixed in 10% neutral buffered formalin (Anatech Ltd.) for 24 hours ...
-
No products found
because this supplier's products are not listed.
Annu Nummi, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Secondary antibody was an HRP-polymer anti-rabbit antibody (BiositeHisto Nordic Biosite cat. no KDB-Z47C3W). Immunoreactivity of antibodies was controlled in sections of porcine kidney ...
-
No products found
because this supplier's products are not listed.
Opeoluwa O. Oyewole, St Patrick Reid,
bioRxiv - Microbiology 2020
Quote:
... and immunoprecipitated using anti-SK2 antibody or an Ig control antibody (ECM Biosciences, Versailles, KY, USA). After a 1 h antibody incubation ...
-
No products found
because this supplier's products are not listed.
Radostin Danev, et al.,
bioRxiv - Biophysics 2020
Quote:
... the grids were glow discharged in low pressure air with 10 mA current in a PIB-10 Ion Bombarder (JEOL, Japan). Cryo-EM grids were prepared by plunge-freezing in liquid ethane on a Vitrobot Mark IV (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Kacee A. DiTacchio, Luciano DiTacchio,
bioRxiv - Molecular Biology 2022
Quote:
... we seeded 2 million cells of the desired clone onto a 10 cm dish and delivered Cre via adenovirus (10 x106 pfu per 2 million cells, Vector BioLabs).
-
No products found
because this supplier's products are not listed.
Paeton L. Wantuch, et al.,
bioRxiv - Microbiology 2022
Quote:
... 10 μL of baby rabbit complement (Pel-Freez Biologicals) was added to wells at a final concentration of 10% and incubated for an additional 1 h at 37 °C with shaking ...
-
No products found
because this supplier's products are not listed.
Daisuke Ariyasu, et al.,
bioRxiv - Genetics 2019
Quote:
... and 0.5 x 106 cells seeded in DMEM with 10% FBS in a 24-well plate with 10 μM MG132 (Peptide Institute, Osaka, Japan), or DMSO ...
-
No products found
because this supplier's products are not listed.
Yongchao Han, Lei Peng, Tao Wang,
bioRxiv - Neuroscience 2021
Quote:
... (10–40 Ci/mM, American radiolabeled chemicals, Saint Louis, USA) uptake were measured as described (Han et al. ...
-
No products found
because this supplier's products are not listed.
Sruthi Purushothaman, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Axolotls were euthanized and fixed in 10% neutral buffered formalin (NBF, StatLab) for imaging.
-
No products found
because this supplier's products are not listed.
Natalia Salvadores, et al.,
bioRxiv - Cell Biology 2022
Quote:
... samples were incubated for 10 min in Amylo-Glo® RTD (Biosensis), washed ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... followed by fixation with a 10% trichloroacetic acid (TCA; Bioshop Canada Inc) at 4°C for one hour ...
-
No products found
because this supplier's products are not listed.
Jack George, Howard T. Jacobs,
bioRxiv - Molecular Biology 2019
Quote:
... custom rabbit polyclonal antibodies (21st Century Biochemicals, both 1:5000), GAPDH (Everest Biotech EB06377 ...
-
No products found
because this supplier's products are not listed.
Daniel D. Lane, et al.,
bioRxiv - Bioengineering 2024
Quote:
... DLS readings were three averaged runs of 10 sub runs at 25 °C in BRAND 40 μL disposable cuvettes (BrandTech Scientific, USA). Zeta potential measurements were averaged over 3 reads at 20°C using autosense for each read in bent capillary cells (Malvern) ...
-
No products found
because this supplier's products are not listed.
Patrícia Aline Gröhs Ferrareze, et al.,
bioRxiv - Microbiology 2020
Quote:
... manual correction of genes from chromosomes 9 and 14 was performed with the software Artemis (Carver et al., 2012), the R265 genome (NCBI assembly GCA_002954075.1) ...
-
No products found
because this supplier's products are not listed.
Dante Disharoon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... μWheel velocity was tracked using brightfield microscopy on a Prior Open Stand microscope (Prior Scientific, Cambridge, UK) with a PCO Panda camera (PCO Imaging ...
-
No products found
because this supplier's products are not listed.
Kevin C. Corbit, et al.,
bioRxiv - Physiology 2019
Quote:
... Blood glucose and serum insulin levels were determined by glucometer readings (Bayer Contour) and ELISA (Alpco), respectively ...
-
No products found
because this supplier's products are not listed.
Tony Ngo, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The percentage of cells infected by virus was quantified by flow cytometry following staining of 10 µL of cells with 10 µL of PE-conjugated anti-gp64 antibody (Expression Systems, catalog #97-201) for 20 min in the dark at 4°C ...
-
No products found
because this supplier's products are not listed.
Amy L. Han, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Cells were collected 1 hour after E2 (10−12 M, 10−10 M, 10−8 M) or ethanol (ETOH) (Decon Labs, Inc.) treatment after being EWD for 72 hours ...
-
No products found
because this supplier's products are not listed.
Daniela Londono Vasquez, et al.,
bioRxiv - Cell Biology 2020
Quote:
... with pregnant mare serum gonadotropin (Lee BioSolutions #493-10-10) according to 46,47 ...
-
No products found
because this supplier's products are not listed.
Takanori Eguchi, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Cells were blocked in IHC/ICC blocking buffer high protein (eBioscience, San Diego, CA) for 10 min and then reacted with anti-MZF1 antibody (1:50, C10502; Assay Biotechnology, Fremont, CA) and AlexaFluor488 secondary antibody (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Bogdan Budnik, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Alk5i (Axxora, 10 μM) and T3 (DNSK ...
-
No products found
because this supplier's products are not listed.
Yanan Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 10 mM HEPES Buffer (CELL technologies), 1×GlutaMAX™ (Thermo Fisher Scientific) ...
-
AG-82 is an inhibitor of epidermal growth factor receptor kinase with an IC50 value of 3 µM in...
Cat# 118409-58-8,
Inquire
Ask
Marco Tigano, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 10 μg/ml insulin (BOC Sciences), 2 mM L-glutamine (Gibco™) ...
-
No products found
because this supplier's products are not listed.
Andrew G. DeMarco, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 10 µM bestatin) in a disrupter genie (Scientific Industries) until >90% lysis was achieved based on microscopic estimation ...
-
No products found
because this supplier's products are not listed.
Lina Marcela Carmona, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A total of 10 nL of 4% FluoroGold (Fluorochrome) was injected ...
-
No products found
because this supplier's products are not listed.
Lauren T. Gill, et al.,
bioRxiv - Biochemistry 2022
Quote:
... except for an ubiquitin specific primary antibody (1:1000 dilution; UBCJ2, Mono- and polyubiquinated conjugates monoclonal antibody, FroggaBio).
-
No products found
because this supplier's products are not listed.
Tongtong Li, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and FLAG antibody (Zen-Bio, Chengdu, China) were used to detect the proteins.
-
No products found
because this supplier's products are not listed.
Cunxi Wang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... concentrated and buffer-exchanged into 10 mM sodium carbonate/bicarbonate pH 10 using a 12 to 14 kDa Spectra/Por® 2 Dialysis Membrane (Spectrum Laboratories, Inc.) followed by centrifugal concentration devices (Amicon® Ultra-15 Centrifugal Filter Unit ...
-
No products found
because this supplier's products are not listed.
James A. Gregory, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and anti-HA antibodies (Immunoreagents #MuxOt-111-DALP), biotin conjugated anti-HA (Biolegend 901505 ...
-
No products found
because this supplier's products are not listed.
Michael Bowe, et al.,
bioRxiv - Immunology 2023
Quote:
... and secondary IgA and IgM antibodies (Brookwood Biomedical).
-
No products found
because this supplier's products are not listed.
JM Sweeter, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Mouse AECs were stained for Muc5b by mouse monoclonal antibody 3AE (27) and rabbit antibody Scgb1a1 (Seven Hills BioReagents WRAB-3950).
-
Peptide to [Nle253]-HSV-1 UL 26 Open Reading Frame (238-257)
Cat# CCP1795,
1 mg USD $208.0, 5 mg USD $520.0, 10 mg USD $780.0
Ask
Rafał Zdrzałek, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Respective primary HRP-conjugated antibodies (α-FLAG: Cohesion Biosciences, CPA9020 ...
-
No products found
because this supplier's products are not listed.
Nana Naetar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cells were stained with an anti-mEos2 antibody (Badrilla, Leeds, UK) following the standard IF protocol.
-
No products found
because this supplier's products are not listed.
Wee-Han Poh, et al.,
bioRxiv - Microbiology 2020
Quote:
... Samples were injected using 10 µL with a 234 autosampler (Gilson, Limburg-Offheim, Germany). Resolved compounds were analysed with a refractive index detector (RID-10A ...
-
No products found
because this supplier's products are not listed.
Zoe J. Looser, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and the tissue homogenizer Bullet Blender (BBX24, Next Advance; 2 x 15 s cycles on setting 10). The TMT-based quantitative proteomics was conducted by the Functional Genomics Center Zurich (FGCZ ...