Labshake search
Citations for Roche :
1 - 50 of 3286 citations for Chromosome 10 Open Reading Frame 82 C10ORF82 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... 1µg of DNA was labeled with digoxigenin (for chromosome III) or biotin (for chromosome V) by nick-translation according to manufacturer instructions (Roche, 11745816910 and 11745824910).
-
bioRxiv - Cancer Biology 2019Quote: ... bacterial artificial chromosome (BAC) clones were labeled with biotin- (Roche), digoxigenin- (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2021Quote: ... Chromosome surface spreads were immunostained with rat –-HA at 1:200 (Roche) and rabbit –-Hop1 at 1:200 (home made)) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Chromosome slides were subjected to the detection with avidin-FITC (Roche, Basel, Switzerland) and then counterstained with DAPI in VECTASHIELD Antifade Mounting Medium (Vector Laboratories ...
-
bioRxiv - Genomics 2019Quote: FISH probes were prepared from bacterial artificial chromosomes (BACs) using nick/translation (Roche 11745808910). 1ug BAC DNA was used in each 20uL nick/translation reaction along with the following fluorophores ...
-
bioRxiv - Genomics 2022Quote: BAC (Bacterial Artificial Chromosome) probes were generated by the nick translation DNA labeling system (Roche, Cat. No. 11745808910). The green and red probes described in this study were labeled by Digoxigenin (DIG ...
-
bioRxiv - Immunology 2021Quote: ... All PCR reactions were done using KAPA HiFi high fidelity proof reading polymerase (KAPA Biosystems). Libraries were sequenced using NexsSeq 550 (200 bp forward read ...
-
bioRxiv - Genomics 2020Quote: ... and a potential large inversion on chromosome 4 (Supplementary Table 11) were labeled with digoxigenin-11-dUTP (Roche, Indianapolis, IN), biotin-16-dUTP (Roche) ...
-
bioRxiv - Cancer Biology 2021Quote: Four consecutive and non-overlapping fragments from the pSP64 HPV16 bacterial artificial chromosome were PCR amplified using the Expand High Fidelity PCR system (Roche). This resulted in complete coverage of the HPV16 genome ...
-
bioRxiv - Biophysics 2022Quote: ... B1 and ACS elements) was amplified from the yeast chromosome (S288C_ChrIV BK0069382: 462,279–462,787) and inserted into λ DNA (Roche, Cat# 11558706910) with XhoI and NheI restriction enzymes (New England BioLabs) ...
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antibodies were used in MABT/10% horse serum/10% Western Blocking Reagent (Sigma-Roche) at a concentration of 1:2000 for anti-digoxigenin-POD (Sigma-Roche #11207733910 RRID ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Genomics 2019Quote: ... trachomatis molecular diagnosis was performed by using a dual-target (chromosome plus plasmid) commercial nucleic acid amplification test (NAAT) (Cobas® 4800 CT/NG from Roche Diagnostics) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: Probes used were a Huwe1 bacterial artificial chromosome, BAC (BACPAC Resources Center, RP24-157H12) and oligos (∼75 nucleotides long) covering all Xist exons (Roche, custom design). The BAC was labelled using the Nick Translation kit from Abbot and following manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... in dissociation buffer (DB; 82 mM Na2SO4, 30mM K2SO4, 10mM Glucose, 2.5mM MgCl2,10mM Hepes pH7.4, and RNase inhibitor [Protector, Roche]). Pellets containing nuclei were resuspended in DB and filtered with 70 um and 40 um strainers ...
-
bioRxiv - Biochemistry 2023Quote: ... SUPREM variants were purified by affinity chromatography in an open column using cOmplete His-Tag Purification Resin (Roche, Basel, Switzerland), eluting with 20 mM HEPES pH 7.0 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antibodies were used in TNTx/10% horse serum (Roche, Basel Switzerland) at a concentration of 1:2000 for anti-DIG-POD (Roche ...
-
bioRxiv - Immunology 2023Quote: ... Mice were tested weekly and considered diabetic after two consecutive blood glycemia readings of > 250 mg/dL using an ACCU-CHEK blood glucose monitor (Roche).
-
bioRxiv - Pathology 2023Quote: ... and six hour fasting blood glucose was measured four weeks into the experiment and four weeks prior to euthanasia (tail tip bleed readings by Accu-Chek, Roche). After 24 weeks of hyperlipidemia ...
-
bioRxiv - Cancer Biology 2023Quote: ... and real-time analysis of the thermal stability of the protein was performed by fluorescence reading (excitation: 465 nm, emission: 580 nm) on a Light Cycler 480 (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... Sections were hybridized with antisense RNA probe for IR84a (nucleotides 82-780) or IR8a (nucleotides 4-529) sequence labelled using in vitro transcription with digoxigenin-11-UTP (Roche). The signals were visualized with a nonradioactive detection system using anti-digoxigenin Fab fragment conjugated to alkaline phosphatase (Roche).
-
bioRxiv - Molecular Biology 2019Quote: ... Immunoprecipitation was performed using 10 µg of anti-GFP antibody (Roche, 11814460001) (used for Hap2-GFP IP ...
-
bioRxiv - Plant Biology 2023Quote: ... The complete cDNA encoding the complete starch branching enzyme mature isoforms (devoid of their putative transit peptides) were amplified from a Chlamydomonas cDNA bank using the proof-reading Kapa Hifi Hot start polymerase (Roche Diagnostics, Austria) and cloned into the pENT-D-Topo plasmid (Thermofisher ...
-
bioRxiv - Genetics 2021Quote: ... 0.1% BSA and incubated with antibodies (10 µL anti-GFP (1:1000, Roche ref:11814460001)/50 µL beads ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated for 10 min at 37°C with anti-HA antibody (3F10; Roche) (1:3000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The embryos were then transferred to TBST containing 10% HISS and anti-DIG-AP antibody (Roche, 11093274910) at a dilution of 1:2000 overnight at 4C with constant rocking ...
-
bioRxiv - Genomics 2023Quote: ... (d) Remaining 9/10 of sample is immunoprecipitated with 1:1000 anti-HA antibody (0.1mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Supernatant was separated from lysates by centrifugation at 20,000×g for 10 minutes and used for immunoprecipitation using 20 µg of anti-GFP antibody (11814460001, Roche) (used for GFP-CENP-ACnp1 and Hap2-GFP IP ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated for in donkey anti-mouse FITC antibody diluted in 10 X blocking buffer (1:100; Roche) + 0.3 % Triton-X100 for 1 h ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were blocked in 10% inactivated sheep serum for 1 h followed by overnight incubation with 1:1000 anti-digoxygenin (DIG) antibody (Roche). The sections were washed in PBT and incubated with NBT/BCIP (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... and between WT mice treated with either 10 mg/kg of a functional blocking antibody against CDH11 (SYN0012; used with permission from Roche) or an isotype control antibody (IgG2a) ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were incubated live for 10 min at 37 °C with anti-HA rat monoclonal antibody (1:100, 11867423001, Roche) or anti-GFP mouse monoclonal antibody (1:200 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with α-DIG or α-fluorescein antibody conjugated with alkaline phosphatase (Roche, 1:2000 in 10% FBS/PBST) at 4°C overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... and blocked in 10% Sheep Serum for 2 hours followed by incubation with an anti-DIG antibody (1:2000) (Roche) in TBST / 1% sheep serum overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were blocked in 10% inactivated sheep serum for 1 h followed by overnight incubation with 1:1000 anti-digoxygenin (DIG) antibody (Roche). The sections were washed in PBT and incubated with NBT/BCIP (Roche ...
-
bioRxiv - Genomics 2023Quote: ... slides were deparaffinized and automatically stained with specific antibodies against synovial cell markers (PECAM-1, DAKO JC/70a, 1:10; CD20, Ventana Roche L26 ...
-
bioRxiv - Neuroscience 2023Quote: ... Washes were followed by blocking in 10% heat-inactivated sheep serum for 1-3 hours and incubation in buffer containing sheep antidigoxigenin antibody (Roche) at 1:5000 dilution for 16-20 hours at 4oC ...
-
bioRxiv - Plant Biology 2024Quote: ... The immuno-complexes was then analysed on a 10% SDS-PAGE gel using immunoblotting methods with anti-HA antibodies (Anti-HA High Affinity Roche 3F/10 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 10% sheep serum] and incubated with a 1:2000 dilution of alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche Cat# 11093274910) in MABT/Block at 4°C overnight ...
-
bioRxiv - Plant Biology 2022Quote: ... and the supernatant containing the immunoprecipitated protein was resolved in a 10% SDS-PAGE gel and detected by an anti-HA antibody (Roche, 12158167001).
-
bioRxiv - Microbiology 2023Quote: ... 10% SDS) buffer containing 10% protease inhibitor cocktail (Roche) for 30 min on ice ...
-
bioRxiv - Biophysics 2023Quote: ... 1% Triton X-100, 10% glycerol, 10 mM NaH2PO4, 10 mM NaP2O7, 100 μM ZnCl2, 10 mM NaF, 1 Roche protease inhibitor tablet), lysed by sonication and the supernatant isolated by centrifugation ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were blocked with 10% lamb serum in TBST for 1 hour at RT and incubated with alkaline phosphatase conjugated to DIG antibody (Roche, Basel, Switzerland) in TBST ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10% glycerol + 1:10 cOmplete mini protease inhibitor cocktail (Roche)) by incubation on ice followed by sonication (Bioruptor ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were washed and the secondary antibodies applied (dilutions listed below) with 4′-6-diamidino-2-phenylindole (DAPI: Cat # 10-236-276-001, Roche Diagnostics, Indianapolis, IN) at 1:1,000 for 1 hour ...
-
bioRxiv - Genomics 2024Quote: ... Cell pellets were resuspended in 250 µL ice-cold Hi-C lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA630, 1 tablet/10 mL Roche complete mini EDTA-free protease inhibitor) ...
-
bioRxiv - Genomics 2021Quote: ... and then resuspended in Antibody buffer (10 mM HEPES pH 150 mM NaCl, 2 mM spermidine, 2 mM EDTA, 0.1% BSA, and Roche complete EDTA-free protease inhibitor) with primary anti-Pol2S5p antibody (Cell Signaling Technology cat ...