Labshake search
Citations for Takara Bio :
2151 - 2200 of 7163 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... MYCN 5′ DEL and 3′ DEL deletion mutants were generated by restriction-free cloning using plasmid PCR amplification and overhang ligation using the In-Fusion Cloning Kit (Takara Bio 638910) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: The q-PCR standards were synthesized by cloning target genes into Escherichia coli DH5a using a PMD18-T vector Cloning Kit (TaKaRa Biotechnology, China). Vector concentrations were measured using NanoDrop ...
-
bioRxiv - Immunology 2023Quote: ... The DNA product was purified from the gel slice using the PCR cleanup and gel extraction kits (740609.50, Takara Bio, Kusatsu, Shiga). The purified DNA was cleaned using AMPure XP (A63881 ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector20 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the PCR products were subcloned into EcoRV site of pBluescript SK- vector using In-Fusion® HD Cloning Kit (TaKaRa Bio, Japan) and sequenced with the M13 forward primer (5’-GTAAAACGACGGCCAG-3’ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The PCR products were used as templates to synthesize specific dsRNA using the in vitro Transcription T7 Kit (TaKaRa Biotechnology, Dalian, China) (dsRNA-Vitro ...
-
bioRxiv - Cell Biology 2023Quote: ... Isolated DNA was amplified by PCR using Hot Start TaKaRa LA Taq kit to yield a 10-Kb product (Takara Biotechnology, #RR042A). Primers utilized were the following ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting PCR fragment was subcloned into the KpnI-NotI site of the pCAGGS vector10 using In-Fusion HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Genetics 2023Quote: ... The full-length cDNAs of SUH1 and BC10 were amplified using the Taq LA DNA polymerase PCR kit from Takara (https://takara.com/) with cDNA-specific primers (Supplementary Table S2) ...
-
bioRxiv - Cell Biology 2024Quote: ... Constructs that express wrmScarlet-tagged V-ATPase components with gfp::unc-54 3’ UTR were generated using the In-Fusion Advantage PCR cloning kit (Clontech, Cat. #639621). The primers were listed in Extended Data Table 3.
-
bioRxiv - Molecular Biology 2024Quote: ... Final NGS libraries were generated using 2ng of the purified 1st PCR product using the dual-indexing Illumina-compatible DNA HT Dual Index kit (Takara #R4000660,R400661). 2nd PCR products were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were purified by Nucleospin® Gel and PCR Clean-up (740609-250; TAKARA).
-
bioRxiv - Genetics 2020Quote: ... eas and RhoGEF) for qRT-PCR were generated by PCR using Tks Gflex DNA Polymerase (TaKaRa) and gene-specific primers (Table S1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification was performed using a CloneAmp™ HiFi PCR Premix (Takara, Mountain View, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Both 1st PCR and 2nd PCR were performed by using PrimeSTAR HS DNA polymerase from Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... A 10,143 kb fragment was amplified by PCR in a thermal cycler (TaKaRa PCR Thermal Cycler) using the following primers ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... the first PCR reaction mixture (30 cycles) was purified with a PCR cleanup column (Takara Bio) and the eluate was used for the second PCR reaction (30 cycles) ...
-
bioRxiv - Genetics 2019Quote: ... PCR reactions contained 10 μl SapphireAmp Fast PCR Master Mix (Takara Bio USA, Mountain View, CA), 0.3 μl of each primer (10 μM stocks) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Molecular Biology 2019Quote: ... Two PCR amplicons were prepared in each case using CloneAmp™ HiFi PCR Premix (638500; Clontech) and were then gel-eluted using NucleoSpin® Gel and PCR Clean-up (740609.10 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR and quantitative-PCR were performed with Takara Taq Hot Start Version (TaKaRa Biotechnology, Shiga, Japan) or Power SYBR Green PCR master mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutants (N127143Q and motif substitutions) were obtained by mutagenesis PCR using CloneAmp HiFi PCR Premix (TakaRa). The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene) ...
-
bioRxiv - Genomics 2020Quote: ... Used cDNA template was further split into two PCR reactions with Terra PCR Direct Polymerase (Takara) with the following program 98°C for 2min ...
-
bioRxiv - Genomics 2019Quote: ... Lentiviral particles were concentrated ∼100 times using Lenti-X Concentrator (Takara). LUHMES cells were seeded in a 12-well-plate format and immediately transduced with 30 ul of virus concentrate ...
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified from pEGFP-C1 (Clontech), at the NheI-XhoI sites of the pCI-Neo vector and then by adding the fragment encoding GIGYF2 at the XhoI-NotI sites ...
-
bioRxiv - Bioengineering 2019Quote: ... with CloneAmp HiFi PCR premix (Clontech). The additional variants G462N/W/L/C/I/F/A/H/Y were generated using the Q5 and QuikChange site directed mutagenesis kits ...
-
bioRxiv - Cell Biology 2021Quote: ... or CloneAmp HiFi PCR Premix (Takara)) and sequences of plasmids were confirmed by Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed using PrimeStarMax (TaKaRa), and the resulting products were checked on agarose gel (1% ...
-
bioRxiv - Molecular Biology 2023Quote: CloneAmp™ HiFi PCR Premix (Takara) and 1 µl DMSO were mixed in a total volume of 25 µl H2O ...
-
bioRxiv - Molecular Biology 2023Quote: ... including PCR using PrimeSTAR GXL (Takara), and DpnI treatment (Takara) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR with Advantage 2 (Takara 639207). 5 µL of ligation sample ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR was performed using Phusion (Takara), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed with Gflex (TaKaRa) under the temperature profile of an initial denaturation at 94°C for 1 min followed by 30 cycles of 98°C for 10 s ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of PHOT1-citrine was done using Living Colors anti-GFP antibody JL-8 (632381, Clontech), 1:4000 in PBS 5% milk 0,1% tween (PBSTM) ...
-
bioRxiv - Genomics 2020Quote: RNA preparations of similar quality from adult mouse testis and sperm were used for constructing PacBio IsoSeq libraries (SMRT bell libraries). Full-length cDNA was synthesized using the Clontech SMARTer PCR cDNA Synthesis kit (Cat. # 634925) (Clontech, Palo Alto, CA). Approximately 13-15 PCR cycles were required to generate 10-15 µg of ds-cDNA from a 1 µg RNA sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Genetics 2019Quote: ... RNA was reverse transcribed using SMART-Seq Reverse Transcriptase followed by 11 cycles of PCR amplification (SMART-Seq v4 kit, Takara Bioscience, Cat. 634890). Purification and size selection of DNA was carried out using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using proofreading DNA polymerases (Phusion HF, New England Biolab, Ipswich, MA) and In-Fusion HD Cloning Kit (Clontech, Mountain View, CA) or NEBuilder HiFi DNA Assembly Cloning Kits (New England Biolab) ...
-
bioRxiv - Genomics 2024Quote: The Iso-Seq libraries were constructed from 1 µg of total RNA per sample and full-length cDNA were then generated using the SMARTer PCR cDNA synthesis kit (Takara Bio Inc, 639506). The libraries were sequenced on the Sequel Instrument v1 ...
-
bioRxiv - Plant Biology 2023Quote: ... Each one or two PCR fragments were inserted into pMpGWB300 that was cleaved by HindIII and SalI using the In-Fusion Cloning kit (TaKaRa Bio, Kusatsu, Japan) to generate pMpGWB300:proMpRKD:MpRKD and pMpGWB300:proMpRKD:mMpRKD plasmids.
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 ng of total RNA were reverse transcribed using the PrimeScript™ RT Master Mix (Takara). Promega’s GoTaq® Probe qPCR Master Mix was used according to the manufacturer’s instructions with gene specific primers and probes (see Extended data table 7) ...
-
bioRxiv - Genomics 2022Quote: ... 100 ng of RNA was reverse transcribed into cDNA using PrimerScriptTM RT Master Mix (TaKaRa, #RR036A). Next ...
-
bioRxiv - Systems Biology 2021Quote: ... 500 ng total RNA was used for reverse transcription with PrimeScript RT with gDNA eraser (Takara). For relative transcript quantification PowerUp SYBR Green (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was carried out using PrimeScript RT Master Mix (Takara Bio, Otsu, Japan. Ref: RR036A). Optical density analysis using a Nanodrop ND-1000 spectrophotometer (Labtech ...