Labshake search
Citations for Takara Bio :
2051 - 2100 of 6767 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... A 10,143 kb fragment was amplified by PCR in a thermal cycler (TaKaRa PCR Thermal Cycler) using the following primers ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... the first PCR reaction mixture (30 cycles) was purified with a PCR cleanup column (Takara Bio) and the eluate was used for the second PCR reaction (30 cycles) ...
-
bioRxiv - Genetics 2019Quote: ... PCR reactions contained 10 μl SapphireAmp Fast PCR Master Mix (Takara Bio USA, Mountain View, CA), 0.3 μl of each primer (10 μM stocks) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Molecular Biology 2019Quote: ... Two PCR amplicons were prepared in each case using CloneAmp™ HiFi PCR Premix (638500; Clontech) and were then gel-eluted using NucleoSpin® Gel and PCR Clean-up (740609.10 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR and quantitative-PCR were performed with Takara Taq Hot Start Version (TaKaRa Biotechnology, Shiga, Japan) or Power SYBR Green PCR master mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutants (N127143Q and motif substitutions) were obtained by mutagenesis PCR using CloneAmp HiFi PCR Premix (TakaRa). The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene) ...
-
bioRxiv - Genomics 2020Quote: ... Used cDNA template was further split into two PCR reactions with Terra PCR Direct Polymerase (Takara) with the following program 98°C for 2min ...
-
bioRxiv - Genomics 2019Quote: ... Lentiviral particles were concentrated ∼100 times using Lenti-X Concentrator (Takara). LUHMES cells were seeded in a 12-well-plate format and immediately transduced with 30 ul of virus concentrate ...
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified from pEGFP-C1 (Clontech), at the NheI-XhoI sites of the pCI-Neo vector and then by adding the fragment encoding GIGYF2 at the XhoI-NotI sites ...
-
bioRxiv - Bioengineering 2019Quote: ... with CloneAmp HiFi PCR premix (Clontech). The additional variants G462N/W/L/C/I/F/A/H/Y were generated using the Q5 and QuikChange site directed mutagenesis kits ...
-
bioRxiv - Cell Biology 2021Quote: ... or CloneAmp HiFi PCR Premix (Takara)) and sequences of plasmids were confirmed by Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...
-
bioRxiv - Molecular Biology 2023Quote: CloneAmp™ HiFi PCR Premix (Takara) and 1 µl DMSO were mixed in a total volume of 25 µl H2O ...
-
bioRxiv - Molecular Biology 2023Quote: ... including PCR using PrimeSTAR GXL (Takara), and DpnI treatment (Takara) ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed using PrimeStarMax (TaKaRa), and the resulting products were checked on agarose gel (1% ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of PHOT1-citrine was done using Living Colors anti-GFP antibody JL-8 (632381, Clontech), 1:4000 in PBS 5% milk 0,1% tween (PBSTM) ...
-
bioRxiv - Genomics 2020Quote: RNA preparations of similar quality from adult mouse testis and sperm were used for constructing PacBio IsoSeq libraries (SMRT bell libraries). Full-length cDNA was synthesized using the Clontech SMARTer PCR cDNA Synthesis kit (Cat. # 634925) (Clontech, Palo Alto, CA). Approximately 13-15 PCR cycles were required to generate 10-15 µg of ds-cDNA from a 1 µg RNA sample ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Genetics 2019Quote: ... RNA was reverse transcribed using SMART-Seq Reverse Transcriptase followed by 11 cycles of PCR amplification (SMART-Seq v4 kit, Takara Bioscience, Cat. 634890). Purification and size selection of DNA was carried out using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification using proofreading DNA polymerases (Phusion HF, New England Biolab, Ipswich, MA) and In-Fusion HD Cloning Kit (Clontech, Mountain View, CA) or NEBuilder HiFi DNA Assembly Cloning Kits (New England Biolab) ...
-
bioRxiv - Plant Biology 2023Quote: ... Each one or two PCR fragments were inserted into pMpGWB300 that was cleaved by HindIII and SalI using the In-Fusion Cloning kit (TaKaRa Bio, Kusatsu, Japan) to generate pMpGWB300:proMpRKD:MpRKD and pMpGWB300:proMpRKD:mMpRKD plasmids.
-
bioRxiv - Genomics 2024Quote: The Iso-Seq libraries were constructed from 1 µg of total RNA per sample and full-length cDNA were then generated using the SMARTer PCR cDNA synthesis kit (Takara Bio Inc, 639506). The libraries were sequenced on the Sequel Instrument v1 ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 ng of total RNA were reverse transcribed using the PrimeScript™ RT Master Mix (Takara). Promega’s GoTaq® Probe qPCR Master Mix was used according to the manufacturer’s instructions with gene specific primers and probes (see Extended data table 7) ...
-
bioRxiv - Genomics 2022Quote: ... 100 ng of RNA was reverse transcribed into cDNA using PrimerScriptTM RT Master Mix (TaKaRa, #RR036A). Next ...
-
bioRxiv - Systems Biology 2021Quote: ... 500 ng total RNA was used for reverse transcription with PrimeScript RT with gDNA eraser (Takara). For relative transcript quantification PowerUp SYBR Green (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was carried out using PrimeScript RT Master Mix (Takara Bio, Otsu, Japan. Ref: RR036A). Optical density analysis using a Nanodrop ND-1000 spectrophotometer (Labtech ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA solution was subjected to RT-qPCR using TB Green Premix Ex Taq (Takara, rr420a) and prime script rt master mix (Takara ...
-
The logic of native enhancer-promoter compatibility and cell-type-specific gene expression variationbioRxiv - Genomics 2022Quote: ... Isolated RNA (500 ng) was reverse-transcribed to cDNA by using PrimeScript RT master mix (Takara). PCR was performed using Mx3005P (Agilent ...
-
bioRxiv - Microbiology 2022Quote: cDNA was synthesized from 300–500 ng total RNA using the PrimeScript RT Master Mix (Takara) in a volume of 10 µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... and reverse transcribed into cDNA using a PrimeScript RT Master Mix (Takara RR036A, Kusatsu, Shiga, Japan). Quantitative real-time RT-PCR analysis was performed using TB Green Premix Ex Taq (Clontech ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng total RNA was reverse transcribed into cDNA with the PrimeScript RT Master Mix (TaKaRa). qPCR was performed using corresponding primers listed in SI Appendix ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was carried out using TB Green® Premix Ex Taq™ GC (TaKaRa, RR071Q). Gene expression data were normalized to sigA and expressed as fold change using the 2−ΔΔCt method compared to wild-type strain or untreated control.
-
bioRxiv - Cell Biology 2023Quote: ... 400 ng of RNA was used for reverse transcription using PrimeScript RT Master Mix (Takara, USA). PCR reactions were performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed using the SYBR-Green PCR Master mix (SYBR® Premix Ex Taq™, Takara) and a CFX96 thermal cycler (BioRad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse PCRs were performed in two rounds using CloneAmp HiFi PCR premix (Clontech, Mountain View, CA, USA). The first round was performed adding the forward and reverse primers in two independent reactions and consisted of 3 cycles of 98 °C for 10 seconds ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-st PCR (PCR 1) was performed using Titanium Taq DNA Polymerase (# 639209, Takara Bio, CA, USA). Separation of the PCR products from primers and gel purification was done by QIAquick PCR & Gel Cleanup Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed by SYBR Green PCR Master Mix (Takara). The primer sequences for qRT-PCR were listed in Table S15.
-
bioRxiv - Developmental Biology 2024Quote: ... 1 ul of the cDNA was used for PCR reaction using CloneAmp HiFi PCR Premix (Takara, 639298) with the following primers ...
-
bioRxiv - Cancer Biology 2019Quote: ... The PCR product was cloned into pcDNA6/luc/NP3 into a NotI-AgeI site using the Clontech In-Fusion kit (Clontech Laboratories, Mountain View, CA). To remove the two putative MIR211 sites ...
-
bioRxiv - Genomics 2019Quote: ... PCR products were collected by centrifugation at ~2250 xg for 20 min using the supplied SMARTer ICELL8 Collection Kit (Takara Bio USA, Cat.#640048).
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was normalized to 2ng in a total volume of 9μl and then transcribed to cDNA in a dedicated PCR clean workstation using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio, Mountain View, CA). Sequencing libraries were constructed from cDNA using the SMARTer ThruPLEX DNA-Seq kit (Takara Bio) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion and point mutation constructs were produced through inverse PCR using Takara In-Fusion HD cloning kit (#638920) (Takara Bio Inc., Kusatsu, Shiga, Japan). Primers used are listed in supplementary materials.
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...