Labshake search
Citations for Takara Bio :
2201 - 2250 of 7163 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA solution was subjected to RT-qPCR using TB Green Premix Ex Taq (Takara, rr420a) and prime script rt master mix (Takara ...
-
The logic of native enhancer-promoter compatibility and cell-type-specific gene expression variationbioRxiv - Genomics 2022Quote: ... Isolated RNA (500 ng) was reverse-transcribed to cDNA by using PrimeScript RT master mix (Takara). PCR was performed using Mx3005P (Agilent ...
-
bioRxiv - Microbiology 2022Quote: cDNA was synthesized from 300–500 ng total RNA using the PrimeScript RT Master Mix (Takara) in a volume of 10 µL ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was carried out using TB Green® Premix Ex Taq™ GC (TaKaRa, RR071Q). Gene expression data were normalized to sigA and expressed as fold change using the 2−ΔΔCt method compared to wild-type strain or untreated control.
-
bioRxiv - Cell Biology 2023Quote: ... 400 ng of RNA was used for reverse transcription using PrimeScript RT Master Mix (Takara, USA). PCR reactions were performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... and reverse transcribed into cDNA using a PrimeScript RT Master Mix (Takara RR036A, Kusatsu, Shiga, Japan). Quantitative real-time RT-PCR analysis was performed using TB Green Premix Ex Taq (Clontech ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng total RNA was reverse transcribed into cDNA with the PrimeScript RT Master Mix (TaKaRa). qPCR was performed using corresponding primers listed in SI Appendix ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed using the SYBR-Green PCR Master mix (SYBR® Premix Ex Taq™, Takara) and a CFX96 thermal cycler (BioRad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reverse PCRs were performed in two rounds using CloneAmp HiFi PCR premix (Clontech, Mountain View, CA, USA). The first round was performed adding the forward and reverse primers in two independent reactions and consisted of 3 cycles of 98 °C for 10 seconds ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed by SYBR Green PCR Master Mix (Takara). The primer sequences for qRT-PCR were listed in Table S15.
-
bioRxiv - Developmental Biology 2024Quote: ... 1 ul of the cDNA was used for PCR reaction using CloneAmp HiFi PCR Premix (Takara, 639298) with the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-st PCR (PCR 1) was performed using Titanium Taq DNA Polymerase (# 639209, Takara Bio, CA, USA). Separation of the PCR products from primers and gel purification was done by QIAquick PCR & Gel Cleanup Kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... Homology-directed repair templates were PCR amplified using the CloneAmp™ HiFi PCR Premix (Takara Bio, 639298). Guide RNA and repair template sequences are listed in Table S1.
-
bioRxiv - Cancer Biology 2019Quote: ... The PCR product was cloned into pcDNA6/luc/NP3 into a NotI-AgeI site using the Clontech In-Fusion kit (Clontech Laboratories, Mountain View, CA). To remove the two putative MIR211 sites ...
-
bioRxiv - Genomics 2019Quote: ... PCR products were collected by centrifugation at ~2250 xg for 20 min using the supplied SMARTer ICELL8 Collection Kit (Takara Bio USA, Cat.#640048).
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA was normalized to 2ng in a total volume of 9μl and then transcribed to cDNA in a dedicated PCR clean workstation using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio, Mountain View, CA). Sequencing libraries were constructed from cDNA using the SMARTer ThruPLEX DNA-Seq kit (Takara Bio) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The corresponding full-length cDNA library was then generated using 1μg total RNA and the SMARTer PCR cDNA synthesis kit (Clontech, Takara Bio Inc., Shiga, Japan) following PacBio recommendations set out in the Iso-Seq method ...
-
bioRxiv - Cell Biology 2022Quote: ... Deletion and point mutation constructs were produced through inverse PCR using Takara In-Fusion HD cloning kit (#638920) (Takara Bio Inc., Kusatsu, Shiga, Japan). Primers used are listed in supplementary materials.
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cancer Biology 2022Quote: Human c-Jun sequence was amplificated using the cDNA of MCF7-BM02-1 and then transferred to pMXd3-PEF1-IRES-Puro vector using an In-Fusion Advantage PCR Cloning Kit (Clontech Laboratories Inc., CA, USA). The sequence encoding the transactivation domain of c-Jun in pMXs-Jun-IH was kindly provided by Dr ...
-
bioRxiv - Neuroscience 2022Quote: ... qPCR expression analysis was conducted on cDNA derived from immunoprecipitated RNA of OT:RiboTag mice following reverse (SMARTer® PCR cDNA synthesis kit; Takara Bio Inc., Shiga, Japan).
-
bioRxiv - Microbiology 2022Quote: ... The resulting PCR product was then cloned into pVV16-hsp60 between NdeI and HinDIII using In-Fusion® HD cloning kit (Takara Bio USA, Inc) and Stellar™ competent cells ...
-
bioRxiv - Immunology 2024Quote: ... reverse transcription and PCR steps were directly performed after sorting according to the SMART-Seq® v4 Ultra® Low Input RNA Kit protocol (Takara Bio, USA). Amplified complementary DNA were transferred to the Benaroya Research Institute (Seattle ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR fragments of spike protein DNA were cloned into linearized pMRNAXP vector using In-Fusion® HD Cloning Kit (Clontech® Laboratories, Inc.). The cloning mixtures were transformed to One Shot™ TOP10 Chemically Competent E ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reactions at every examined depth were performed in triplicate (n=3) using Takara SpeedSTAR HS DNA polymerase kit (Takara Bio USA, Madison, WI) with the following modifications ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The rRNA genes (18S, ITS, 28S) were amplified by polymerase chain reaction (PCR) using the TaKaRa Ex Taq polymerase kit (TaKaRa Bio-medicals, Seoul, Korea). PCR cycling parameters and primer information were followed as in Shazib et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... the viral supernatant was concentrated 10 times with Lenti-X concentrator (Takara). Media were changed at 24 hours after infection and antibiotics (2 μg/ml puromycin ...
-
bioRxiv - Cell Biology 2022Quote: ... concentrated down 10 times using the Lenti-X Concentrator (631232; Takara Bio). Supernatants were kept at −80°C prior to being directly applied to target cells which were subsequently spun at 700 xg for 1 h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and both long (NM_001300829) and short (NM_001280) isoforms of CIRBP were cloned by PCR (HiFi PCR premix, Clontech) from cDNA from Huh7 cells prepared with the Superscript III RT kit (Thermo Fisher ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant yeast strain was confirmed by PCR conducted with Matchmaker™ Insert Check PCR Mix (TAKARA, Japan). The full length of SlBES1.8 coding sequence was cloned into pGADT7 plasmid and subsequently transformed into the recombinant yeast strain ...
-
bioRxiv - Biochemistry 2020Quote: ... The quantification of gene transcripts was performed by quantitative PCR (Q-PCR) using SYBR Premix Ex Taq (TAKARA). All values were normalized to the level of β-actin mRNA ...
-
bioRxiv - Neuroscience 2020Quote: ... each cDNA was subjected to PCR genotyping using Emerald AMP HS PCR Master Mix (Takara Bio USA #RR330B) and primers shown in Supplementary Table S5 ...
-
bioRxiv - Microbiology 2021Quote: ... and target genes were amplified by conventional PCR (50 µL reactions) with EmeraldAmp GT PCR Master Mix (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... Partial genomic sequences of CpPT1 were PCR amplified in these preparations using SapphireAmp Fast PCR Master Mix (Takara) and the primer pair citron_Fw and citron_Rv (Supplementary Table 8) ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed with the PrimeSTAR Max DNA polymerase 2x hot-start PCR master mix (TaKaRa Bio, R045A). PCR products were purified using the AMPure XP PCR purification system (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products covering the whole sesRNA region was generated with CloneAmp HiFi PCR Premix (Takara, Cat. No. 639298), and purified with NucleoSpin Gel and PCR Clean-up kit (Takara ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 μl PCR mix was dispensed to each well containing the following: 1× SeqAmp PCR buffer (Takara Bio), 0.025 U μl−1 of SeqAmp polymerase (Takara Bio ...
-
bioRxiv - Microbiology 2024Quote: ... Clones were screened for successful insert ligation by colony PCR using EmeraldAmp GT PCR master mix (Takara Bio) with T7 promoter and T7 terminator primers ...
-
bioRxiv - Cell Biology 2024Quote: ... A promoter region in the Sirt1 promoter was amplified by PCR (Terra PCR Direct Red Dye Premix, Takara), the PCR product gel purified (Gel Extraction Kit ...
-
bioRxiv - Genetics 2021Quote: ... RT-qPCR reactions were performed in triplicate with TaqMan Master Mix: Premix Ex Taq (TaKaRa, Otsu, Japan) in a QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: ... then 500 ng of total RNA was reversely transcribed into cDNA using PrimeScriptTM RT Master Mix (TaKaRa) according to the manufacturer’s instructions in a total volume of 10 μL ...
-
bioRxiv - Neuroscience 2020Quote: ... We then added 0.6 μL RT-mix [16.7 U μL−1 SMARTScribe Reverse Transcriptase (Takara Bio, 639538), 1.67 U μl−1 Recombinant RNase Inhibitor (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... cDNAs from 1 μg DNase-treated purified RNA were obtained using PrimeScriptTM RT Master Mix (#RR036A, TAKARA) following the manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... synthesized cDNA with the ReverTra Ace qPCR RT Master Mix (TOYOBO) and used TaKaRa Ex Taq (TaKaRa) for amplification of NSP and MA genes ...
-
bioRxiv - Microbiology 2020Quote: ... The synthesized cDNA was subjected to RT-qPCR using TB Green Premix Ex Taq II (Takara Bio). The PCR conditions were set as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... Complementary DNA (cDNA) was prepared using the 5X Prime Script RT Master Mix (Takara RR-036A-1) with 1 μg of total RNA ...
-
bioRxiv - Neuroscience 2022Quote: ... These RNA samples were then reverse transcribed into cDNA by PrimeScript™ RT Reagent (TaKaRa, RR036A, Japan). Real-time polymerase chain reaction (RT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Plant Biology 2021Quote: ... then RNA was reverse-transcribed into cDNA using PrimeScript RT reagent with gDNA Eraser (Takara, Kusatsu, Japan). TB Green (Takara ...