Labshake search
Citations for Takara Bio :
2351 - 2400 of 7163 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 LR cells) were individually re-amplified using the 5’ PCR Primer II A with CloneAmp HiFi PCR Premix (Clontech Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... was performed via standard and overlapping PCRs with CloneAmp™ HiFi PCR Premix (Takara Bio, cat # 639298, San Jose, CA), with subsequent insertion into the construct at unique restriction sites by In-Fusion ligation- independent cloning (Takara Bio ...
-
bioRxiv - Developmental Biology 2020Quote: ... were transferred into 0.2-mL PCR tubes and processed for sequencing using Seq® v4 Ultra® Low Input RNA Kit (Takara Bio USA, Mountain View, CA) as described in Wood et al ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed Rapid-Amplification-of-cDNA-Ends (RACE) PCR using transcript-specific primers and the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: Plasmids used in this study (Supplementary Table S1) were assembled by Polymerase Chain Reactions (PCR) amplifying insert and vector DNA fragments followed by In-Fusion cloning (Takara Biosciences, In-Fusion HD Cloning Kit). Oligonucleotides (Integrated DNA Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... using SYBR Green PCR Master Mix (Takara, Japan). The relative expression levels of the target gene (EGFP ...
-
bioRxiv - Neuroscience 2019Quote: ... PCR products were cloned into pEGFP-C1 (Clontech) using BamHI and SalI ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR fragments were cloned into pLVX-puro (Clontech) lentivirus vector with Gibson Assembly Mixture (NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... and PCR was performed using PrimeSTAR GXL (Takara) with pCAGItdTomato-Rpsa ...
-
bioRxiv - Microbiology 2021Quote: ... and analyzed by PCR using PrimeSTAR (TaKaRa, R040A). The primers used for monitoring the efficiency of vFLIP knockout are Pr1 (ACCCTGCGTAAACAACCG ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the SYBR green PCR master mix (Takara). Reactions were performed in duplicate or triplicate ...
-
bioRxiv - Plant Biology 2021Quote: ... by PCR using PrimeSTAR GXL DNA Polymerase (TaKaRa) and the primer set RenLuc-pPLV26-F/R (Supplementary Table S11) ...
-
bioRxiv - Microbiology 2021Quote: ... was amplified using CloneAmp HiFi PCR mix (Takara) in a 2-step PCR-program of 98°C for 10 seconds followed by 68°C for 4 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... or by CloneAmp HiFi PCR Premix (Takara Bio). Random mutagenesis was performed using Error-Prone PCR (EP-PCR ...
-
bioRxiv - Genetics 2019Quote: ... PCR was performed using Taq polymerase (TAKR001C, ClonTech) when running DNA fragments on a gel ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Nucleospin Gel and PCR Clean-up (Takara). The sequencing library was sequenced with the Illumina Next-Seq 500 instrument (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... PCR was performed using PrimeSTAR HS (Takara Bio) and T100 Thermal Cycler (Bio-rad ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were digested with DpnI (TaKaRa) at 37°C for 1 h ...
-
bioRxiv - Genetics 2020Quote: ... PCR products amplified using LA Taq polymerase (Takara) or Multiplex PCR Kit (Qiagen ...
-
bioRxiv - Genetics 2020Quote: ... Mutagenic PCR reactions used PrimeStar GXL polymerase (Takara), and 45mer mutagenesis primers (Table S2 ...
-
bioRxiv - Cell Biology 2020Quote: ... EGFP was PCR-amplified from pEGFP-C2 (Clontech) and similarly cloned into the pRSET His-SS-TEV vector ...
-
bioRxiv - Immunology 2020Quote: ... The riboswitch was amplified by PCR (CloneAmp, Takara; according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Using PCR and In-Fusion cloning (Takara Bio), the ‘NGG’ PAM-recognition domain of the prime editor protein (PE2 ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed with Ex-Taq enzyme (TaKaRa) in a total volume of 30 µl containing 1 µl viral DNA ...
-
bioRxiv - Genomics 2022Quote: ... PCR was performed using Taq polymerase (TAKR001C, ClonTech) when running DNA fragments on a gel ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR was performed using KOD DNA polymerase (Takara) with the following settings ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplification (PrimeSTAR Max polymerase, Takara Bio USA), and In-Fusion cloning (In-Fusion Snap Assembly Master Mix ...
-
bioRxiv - Pathology 2024Quote: ... SYBR Green PCR reagent (Takara Co. Ltd., Japan) was chosen for real-time fluorescence quantification ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCR analyses were performed using PrimeStarGXL (TaKaRa) as follows ...
-
bioRxiv - Immunology 2024Quote: ... PCR was performed using Titanium Taq (Takara, #639208) with an extension time of 90s for 30 (1st round ...
-
bioRxiv - Microbiology 2023Quote: ... 1x of PCR buffer (10x, Takara, CA, USA), 10 μL of barcoded primer set forward/ reverse from ONT ...
-
bioRxiv - Microbiology 2023Quote: ... In the In-Fusion PCR cloning system (Clontech), the S1 or S2 gene of the HV80 strain was replaced with the corresponding region of the H120 strain to construct the recombinant plasmids pMDVM8-HV80S1H120S2 and pMDVM8-H120S1HV80S2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... using CloneAmp™ HiFi PCR Premix (Takara 639298) and cloned it (in frame ...
-
bioRxiv - Cell Biology 2023Quote: ... using a Takara Thermal PCR Cycler (Takara Bio). RT-PCR of miRNAs was performed with a Taqman microRNA Reverse Transcription Kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: For PCR reactions PrimeSTAR HS DNA Polymerase (Clontech), Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... PCR was performed using Taq polymerase (TAKR001C, ClonTech) when running DNA fragments on a gel ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR amplification was conducted using PrimeSTAR Max (Takara) or KOD-Plus-Neo (TOYOBO).
-
bioRxiv - Plant Biology 2023Quote: ... the PCR products were digested with SifI (Takara) and cloned into the empty pCambia1305-3xFLAG or pCambia1305-3xHA vectors (gifted by Dr Yuli Ding ...
-
bioRxiv - Molecular Biology 2024Quote: ... GFP was PCR-amplified from pEGFP-N1 (Clontech) and used for Gibson cloning ...
-
bioRxiv - Genomics 2024Quote: ... in SeqAmp CB PCR buffer (Takara Bio., 638526) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... and PCR amplified into 600 bp products (Takara). Indel frequencies were determined through Sanger data-decomposition using the TIDE analysis tool (tide.nki.nl/) ...
-
bioRxiv - Neuroscience 2021Quote: RNA was reverse transcribed into cDNA using Takara PrimeScript RT master mix (RR036A; Takara Biotechnology Co., Ltd., Dalian China). RT-qPCR was performed using an ABI StepOne Plus Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RNA (1 μg) was applied to generate cDNA by means of PrimeScript™RT Master Mix (Takara, RR036A). The real-time quantitative PCR was performed by using SYBR Green Master Mix (Takara ...
-
bioRxiv - Cell Biology 2022Quote: ... Complementary DNA (cDNA) was prepared from 1 μg of RNA using PrimeScriptTM RT Master Mix (catalog no. RR036A, Takara). qPCR was performed using TB Green Premix Ex TaqTM (catalog no ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA synthesis from at least three biological replicates was performed using the PrimeScript™ RT Master Mix (TaKaRa, #RR036A) and real-time PCR was performed using SYBR Green I Master (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... an equal quantity of total RNA (500 ng) was used in reverse transcription (RT) using PrimeScript RTase (Takara Bio). PCR was performed using GoTaq® Green (Promega ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Genomics 2023Quote: 200ng of RNA extracted from whole human blood used as input for reverse transcription using Smartscribe RT (Takara Clontech) with primers targeting the IGH constant regions (IDT ...
-
bioRxiv - Genomics 2023Quote: 200ng of RNA extracted from whole human blood used as input for reverse transcription using Smartscribe RT (Takara Clontech) with primers targeting the IGH constant regions (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... The same amount of total RNAs from each sample were reversely transcribed with PrimeScript RT Master Mix (TaKaRa, RR036A). Diluted cDNAs were mixed with primers and SsoAdvanced Universal SYBR® Green Supermix (BioRad ...