Labshake search
Citations for Takara Bio :
2101 - 2150 of 2518 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... GISAID ID: EPI_ISL_408667) were amplified with polymerase chain reaction (PCR) using PrimeSTAR GXL DNA polymerase (Takara Bio Inc., Shiga, Japan). The corresponding SARS-CoV-2 genomic regions ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
Docking Domain Engineering in a Modular Polyketide Synthase and its Impact on Structure and FunctionbioRxiv - Biochemistry 2023Quote: The DNA encoding VemG and VemH was amplified from the genomic DNA of Streptomyces venezuelae ATCC 10712 (DSMZ) by PCR and introduced into a pET22b(+) expression vector by In-Fusion Cloning (Takara). These expression plasmids were used as a template to generate all engineered venemycin assembly line constructs of this study via In-Fusion Cloning (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Cell Biology 2023Quote: ... CMV-mCherry-SV40-PA was amplified via PCR and the OLIGO273 and OLIGO274 from p-mCherry-N1 without multiple cloning site (modified Clontech, Takara; United States ...
-
bioRxiv - Cell Biology 2023Quote: ... CMV-mCherry-SV40-PA was amplified via PCR and the OLIGO273 and OLIGO274 from p-mCherry-N1 without multiple cloning site (modified Clontech, Takara ...
-
bioRxiv - Genetics 2023Quote: ... The whole fkbA locus from the FK506 resistant isolates was amplified using primers JOHE52223 and JOHE52224 and LA Taq DNA polymerase for long-range PCR with GC Buffer I (Takara). PCR conditions were optimized for long fragments as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA amplification was performed by adding 15 μL of Seq amp PCR mixture (12.5 μL of 2x SeqAmp buffer (Takara Bio), 0.05 μL of 100 μM N-IS PCR primer ...
-
bioRxiv - Pathology 2023Quote: ... Expression levels of the genes were validated by quantitative real-time PCR analysis with SYBR Green (Takara Bio, CA, USA). Cycling parameters were 95°C for 20 seconds ...
-
bioRxiv - Plant Biology 2023Quote: ... The bisulfite-converted library was split between two 50 ul reactions and PCR amplified using the following conditions: 2.5 U of ExTaq DNA polymerase (Takara Bio), 5 μl of 10X Extaq reaction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Microbiology 2023Quote: ... by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pRetroX-TRE3G (TaKaRa). pBS-UGI-flag was constructed by amplifying the UGI and flag sequence from UGI- pFERp44 by PCR and cloning it into the NotI and EcoRI sites of pBluescript II KS(+ ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 14 PCR cycles of amplification was performed for each sample using PrimeSTAR GXL DNA Polymerase (Clontech, UK). Library preparation of the amplified cDNA products was then performed using SMRTbell Template Prep Kit v1.0 (PacBio ...
-
bioRxiv - Biochemistry 2023Quote: ... into which a PCR-amplified DNA fragment containing the mNeonGreen gene (Shaner et al., 2013) was inserted using the in-Fusion reaction (Clontech). To generate pRS426-CPY(1-50)-ATG15(Δ1-35)-mNeonGreen (YPL073) ...
-
bioRxiv - Plant Biology 2023Quote: ... A genomic fragment containing the promotor region and full-length coding region of ATPC1 (At4g04640) was amplified from Col-0 genomic DNA by PCR using PrimeSTAR DNA polymerase (TaKaRa) and the primers ATPC1_F (CACCCATGGAGAGGGCTCGTACCTTAC ...
-
bioRxiv - Genetics 2023Quote: Full-length mouse Rnf212b and Rnf212 cDNAs were amplified by PCR from mouse testis cDNA prepared as above and cloned into pGADT7 and pGBKT7 vectors (Clontech) using the Gibson Assembly Cloning Kit (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... generated cDNA was subjected to real-time PCR analysis using SYBR® Premix Ex Taq™ II kit (TAKARA BIO) with the sets of specific primers (Table 1) ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald/ mApple -VTA1: full-length human VTA1 was amplified by PCR and cloned to mEmerald or mApple -C1 vectors (Clontech). mCh-CHMP4C ...
-
bioRxiv - Cell Biology 2023Quote: ... DNA was extracted in 50 mM NaCl at 100 ℃ for 30 min incubation followed by adjusting pH and PCR reaction using custom designed primers 23 and KOD Hot Start DNA Polymerase (Takara).
-
bioRxiv - Cell Biology 2023Quote: ... an HR repair plasmid was constructed by amplifying homology arms 1000 bp upstream and downstream of the mTurquoise2 insertion site by PCR from genomic DNA obtained from murine CD1 keratinocytes and inserted using InFusion cloning (Takara) into the mTurquoise2-N1 plasmid (Addgene plasmid #54843;http://n2t.net/addgene:54843;RRID:Addgene_54843 ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression plasmids encoding mCherry-tagged PDZ-RhoGEF and its mutants were constructed by inserting the PCR-amplified cDNA fragments into an mCherry-C1 expression plasmid (Clontech). The cDNA fragments were amplified using PrimeSTAR HS DNA polymerase (TAKARA ...
-
bioRxiv - Biochemistry 2023Quote: The gene encoding XccOpgD (GenBank: AAM43366.1) was amplified by PCR with the primer pair shown in Supplementary Table 1 using PrimeSTAR Max (Takara Bio) and a genomic DNA of X ...
-
bioRxiv - Biochemistry 2023Quote: ... LAT1 mutants with amino acid substitutions or an N-terminal truncation (Δ1-50) were constructed by whole-plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara). The corresponding codons were altered as follows for amino acid substitution ...
-
bioRxiv - Cancer Biology 2023Quote: ... The number of virus copies/ml was determined using the Lenti-X™ qRT-PCR Titration Kit (Takara Bioscience, 631235) according to the manual ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription was performed using the oligo (dT) primer and AMV reverse transcriptase contained in the TaKaRa RNA PCR kit (TaKaRa). The RT-PCR was performed using KOD One PCR Master Mix (TOYOBO ...
-
bioRxiv - Molecular Biology 2023Quote: ... flanking the site of alterations (HDE-like motifs) were amplified from the genomic DNA using CloneAmp HiFi PCR Premix (Clontech), A-tailed with DreamTaq DNA polymerase and ligated into pGEM-T Easy vector ...
-
bioRxiv - Cell Biology 2024Quote: ... GlycoM and RGE were generated by PCR of FL using oligonucleotides with mismatch according to inFusion point-mutation protocol (Clontech). For the glycoM plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... AAV titer was determined by qPCR method using AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara-bio, #6233) following the manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... The expression profile of target gene was evaluated using specific primers (Table-3) by using SYBR green RT-PCR master mix (Takara) in BioRad Real time PCR instrument ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR was performed on the Thermal Cycler Dice® Real Time System III instrument (TaKaRa Bio; Tokyo, Japan), The reaction was performed as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... pCold-DDX6 A DNA fragment encoding DDX43 or DDX6 was amplified by PCR and inserted into the pCold-I vector (Takara) using an In-Fusion cloning kit (Takara).
-
bioRxiv - Cell Biology 2024Quote: cfDNA in the conditioned cell culture medium was extracted using NucleoSpin Gel and PCR Clean-up kit (Takara, Duren, Germany), and quantified with Nanodrop (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA levels of the phoP and eptB genes were quantified by PCR using SYBR Premix Ex Taq II (Takara, Japan) solution containing RT-PCR primers for each gene (See Table S2 ...
-
bioRxiv - Neuroscience 2024Quote: ... were purchased from Thermo Fisher Scientific. cDNA synthesis kit (cat no. 6110B) and real-time PCR kit (cat no. PN 4367659) were purchased from TAKARA. ECL reagent (cat no ...
-
bioRxiv - Microbiology 2024Quote: ... Then the total RNA was extracted and reversed transcribed into cDNA for quantitative PCR by using the PrimeScript RT Reagent Kit (TaKaRa). Quantitative real-time reverse transcriptase PCR (qRT-PCR ...
-
bioRxiv - Molecular Biology 2024Quote: ... was amplified from 0.5 µl (5 ng) of a gene fragment in 20 µl using 2X CloneAmp HiFi PCR Premix (Takara Bio) with 250 nM of each primer TAATACGACTCACTATAGGCAATCCGCCCTCACTACAACCG and TCCCTCATCGACGCCAGAGTAG ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 12.5 µl using the Advantage HF 2 PCR Kit (Takara Bio) with 1X Advantage 2 PCR Buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... 4F2hc and mZIP13 or mZIP14 were fused by PCR and In-Fusion® HD Cloning Kit (Takara Bio, Shiga, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmids encoding truncated PARP2 or XRCC1 were generated via PCR-mediated mutagenesis and subcloned into the pEGFP-C1 and mRFP-C1 vectors (Clontech), respectively ...
-
bioRxiv - Microbiology 2024Quote: The 500 bp of DNA upstream and downstream of a target gene were amplified by PCR (Primestar Max DNA Polymerase, Takara). The two 500 bp fragments were then fused by overlapping PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... the RNA was reverse transcribed into complementary DNA by PrimeScript RT (reverse transcriptase) using a primeScript RT-PCR kit (Takara), and qPCR was performed with SYBR Green-Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Systems Biology 2024Quote: ... in conjunction with the Mir-X™ miRNA qRT-PCR TB Green® Kit from TAKARA (San Jose, CA, USA). After confirming miRNA inhibition in tick tissues ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR analysis was performed on an Agilent Real-Time qPCR apparatus (Mx3000P system) using SYBR Premix ExTaq TM II (Takara, Japan). Biological replicates for each set of experiments were carried out three times ...
-
bioRxiv - Cancer Biology 2021Quote: ... and quantitative real-time PCR was performed using the SYBR® Premix Ex Taq II Reagent Kit (Takara, Cat. Cat. #RR820A) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR amplified fragments and linearized vector by restriction enzyme digestion were assembled using In-Fusion HD Cloning Kit (Takara Bio Inc.). pEGFPN3-ARL4C was constructed as previously described(Matsumoto et al ...
-
bioRxiv - Cell Biology 2019Quote: The wild-type SAP domain of SAF-A was amplified by PCR and cloned into a modified pET30a vector containing GFP using In-Fusion cloning (Clontech; pMB1018). SAP-S14D-S26D (pMB1028 ...
-
bioRxiv - Cell Biology 2020Quote: ... Synthesised cDNA was used for analysing the expression of specific genes using gene specific primers (as given in supplementary table 1) in presence Taq polymerase master mix (EmaraldAmp GT PCR Master mix, Takara, Japan).
-
bioRxiv - Genetics 2021Quote: ... was amplified from genomic DNA isolated from tail and peripheral blood using 1 µl of prepped DNA in 20 µl of PCR reaction containing 0.4 µl of PrimerStar GXL (TAKARA Bio, R050A), 4 µl of 5× Buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... falciparum 3D7 strain and homology regions were PCR amplified using PrimeStar GXL DNA polymerase (Takara Bio Inc., Mountain View, CA, USA). The 3’-untranslated homology region (3’-UTR ...